We narrowed to 3 results for: mpg
-
TypeBlog Post...). gGBE consists only of engineered MPG fused to nCas9. First, MPG removes the G base from DNA to create...inosine from DNA: N-methylpurine DNA glycosylase (MPG), also known as alkyladenine DNA glycosylase (AAG...developed for A → G edits, researchers tried inhibiting MPG/AAG to improve editing efficiency, but it didn’t ...researchers at HuidaGene Therapeutics guessed that fusing MPG to an ABE would allow it to act on newly-deaminated...hypoxanthine + a ribose sugar. Their fusion of wild-type MPG to an ABE was able to edit A → Y (Y = T or C) in ...thereafter, using mouse instead of human AAG (remember, MPG and AAG are the same protein!) (Chen et al., 2024...deaminase-free base editor when they realized that MPG could be engineered to act directly on unmodified...
-
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Sherwood pMpGE_En01 71534 Other/Marchantia polymorpha MpU6 none S. pyogenes Hara-Nishimura pMpGE_En03 71535... -
Sequencing Primers
TypeGuide...murine leukemia virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG Mouse PGK promoter, forward...