Skip to main content
Addgene
Showing: 1 - 14 of 14 results

  1. A New Optogenetic Tool Based on AraC Controls Gene Expression with Blue Light

    Type
    Blog Post
    ...This construct, built from the pBAD33 backbone, contains BLADE, the PBAD promoter, and a mCherry reporter...plasmid. It does not include the PBAD promoter. If you already have a pBAD33-based plasmid expressing your...AraC protein that controls transcription from the PBAD promoter. “AraC is widely used in synthetic biology...of AraC using a mCherry reporter downstream of a PBAD promoter. While none of the constructs gave as strong...reporter downstream of the PBAD promoter. To use this plasmid with your gene of interest, you would replace... a previously cloned gene of interest, under the pBAD promoter, can be controlled with light without the...expressing superfolder GFP instead of mCherry under the PBAD promoter. They created a bacterial lawn on an agar...

  2. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mKO2-pBAD - Bacterial Expression TurboRFP 553 574 62 4.4 Dimer TurboRFP-pBAD - Bacterial Expression...Dimer dKatushka-pBAD - Bacterial Expression mKate1.3 588 635 25 Monomer mKate1.31-pBAD - Bacterial Expression...mT-Sapphire-pBAD - Bacterial Expression mAmetrine 406 526 26 6 0.8 hr Monomer (A206K) pBad-mAmetrine -... dimerization pBAD/HisD-rsTagRFP - Bacterial Expression rsEmerald 491 508 rsEmerald-pBAD - Bacterial Expression...Expression EBFP2 383 448 17 4.5 Prone to dimerization pBad-EBFP2 - Bacterial Expression EBFP2-N1 - Mammalian...Expression EBFP2-C1 - Mammalian Expression EBFP2-pBAD - Bacterial Expression moxBFP 385 448 17 Monomer...Expression mKalama1 385 456 16 5.5 Monomer (A206K) pBad-mKalama1 - Bacterial Expression mTagBFP2 399 456...

  3. Plasmids 101: Inducible Promoters

    Type
    Blog Post
    ... expression vectors. Negative inducible promoter pBad is another popular prokaryotic promoter often used...regulatory protein AraC binds O and I1 sites upstream of pBad, blocking transcription. The addition of arabinose... media with glucose decreases cAMP and represses pBad, decreasing promoter leakiness.   Other examples...promoters, pLac is known to be slightly leaky, and pBad is likely a better option since expression can be...

  4. New Acoustic Reporter Genes: Ultrasound Imaging of Gene Expression

    Type
    Blog Post
    ...antibiotics, resulting in the plasmid pBAD-bARGSer-AxeTxe (Fig. 1a).  With pBAD-bARGSer-AxeTxe, gas vesicle expression...systems in E. coli. The arabinose-inducible promoter pBAD and a low-copy number origin of replication (p15A...Expressing bARGSer in E. coli. (a) Plasmid diagram of pBAD-bARGSer-AxeTxe. (b) Methods to assess bARGSer expression...

  5. Fluorescent Proteins 101: Fluorescent Protein Timers

    Type
    Blog Post
    ...2.7/4.7 3.9 h (red) pMedium-FT-N1 pTRE-Medium-FT pBAD/HisB-Medium-FT Slow-FT 402 (blue), 583 (red) ... 2.6/4.6 28 h (red) pSlow-FT-N1 pTRE-Slow-FT pBAD/HisB-Slow-FT -  Applications of fluorescent ...red) 2.8/4.1 7.1 h (red) pFast-FT-N1 pTRE-Fast-FTpBAD/HisB-Fast-FT Medium-FT 401 (blue), 579 (red)...

  6. Bacterial Expression Systems

    Type
    Collection
    ...of tags can be found here . pBAD LIC Series (8-Series) Various Plasmids pBAD (arabinose inducible, glucose...Purpose Murray Lab pBEST plasmids Various Plasmids pBAD, OR2-OR1-PR, pLtetO, pLlacO Arabinose, Anhydrotetracycline...can be found here . pAra Series Various Plasmids pBAD GFP Bryan Berger Reporter system for testing hetero...

  8. Plasmids 101: Protein Expression

    Type
    Blog Post
    ...bacterial cells: the pET, pRSET, Gateway pDEST, and pBAD vectors for example. Protein expression from each...

  9. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...the influence of structure on an FP’s properties. pBAD-LSSmCherry1 is a long Stokes shift variant, which... two-photon microscopy using Ti-Sapphire lasers. pBAD-RDSmCherry1 is a red-shifted variant which, with...

  11. Sequencing Primers

    Type
    Guide
    ...signal, 5' of MCS in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors...vectors with E. coli araBAD promoter, forward primer pBAD Reverse GATTTAATCTGTATCAGG (Invitrogen) For vectors...Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3...

  14. Cre-lox system

    Type
    Collection
    ...vector for Pax7 Tanaka 111187 pBADZ-HisCre Cre; arabinose inducible. PBAD promoter Bacterial Richmond 112614...
Showing: 1 - 14 of 14 results