Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 15 results for: pBAD

Clear keywords
Showing: 1 - 15 of 15 results

  1. A New Optogenetic Tool Based on AraC Controls Gene Expression with Blue Light

    Type
    Blog Post
    ...This construct, built from the pBAD33 backbone, contains BLADE, the PBAD promoter, and a mCherry reporter...plasmid. It does not include the PBAD promoter. If you already have a pBAD33-based plasmid expressing your...AraC protein that controls transcription from the PBAD promoter. “AraC is widely used in synthetic biology...of AraC using a mCherry reporter downstream of a PBAD promoter. While none of the constructs gave as strong...reporter downstream of the PBAD promoter. To use this plasmid with your gene of interest, you would replace... a previously cloned gene of interest, under the pBAD promoter, can be controlled with light without the...expressing superfolder GFP instead of mCherry under the PBAD promoter. They created a bacterial lawn on an agar...

  2. Plasmids 101: Inducible Promoters

    Type
    Blog Post
    ... expression vectors. Negative inducible promoter pBad is another popular prokaryotic promoter often used...regulatory protein AraC binds O and I1 sites upstream of pBad, blocking transcription. The addition of arabinose... media with glucose decreases cAMP and represses pBad, decreasing promoter leakiness.   Other examples...promoters, pLac is known to be slightly leaky, and pBad is likely a better option since expression can be...

  3. New Acoustic Reporter Genes: Ultrasound Imaging of Gene Expression

    Type
    Blog Post
    ...antibiotics, resulting in the plasmid pBAD-bARGSer-AxeTxe (Fig. 1a).  With pBAD-bARGSer-AxeTxe, gas vesicle expression...systems in E. coli. The arabinose-inducible promoter pBAD and a low-copy number origin of replication (p15A...Expressing bARGSer in E. coli. (a) Plasmid diagram of pBAD-bARGSer-AxeTxe. (b) Methods to assess bARGSer expression...

  4. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mKO2-pBAD - Bacterial Expression TurboRFP 553 574 62 4.4 1.5 h Dimer TurboRFP-pBAD - Bacterial ...dKatushka-pBAD - Bacterial Expression mKate1.31 (aka mKate2) 588 635 25 Monomer mKate1.31-pBAD - Bacterial...Expression pBAD-LSSmGFP - Bacterial Expression mAmetrine 406 526 26 6 1.8 min Monomer (A206K) pBad-mAmetrine...EBFP2 383 448 18 5.3 25 min Prone to dimerization pBad-EBFP2 - Bacterial Expression EBFP2-N1 - Mammalian...Expression EBFP2-C1 - Mammalian Expression EBFP2-pBAD - Bacterial Expression moxBFP 385 448 17 Monomer...Expression mKalama1 385 456 16 5.5 Monomer (A206K) pBad-mKalama1 - Bacterial Expression mTagBFP2 399 456...456 32 2.7 12 min Prone to dimerization mTagBFP2-pBAD - Bacterial Expression Return to top Cyan Protein...

  5. Bacterial Expression Systems

    Type
    Collection
    ...FRET Patrick Daugherty 18084 54856 pBad-mAmetrine1.1 tdTomato-pBAD mAmetrine1.1 (donor) tdTomato (acceptor...Nathan Shaner , Roger Tsien 54553 54723 mTFP1-pBAD mCitrine-pBAD mTFP1 (donor) mCitrine (acceptor) FRET/Dual... Michael Davidson 54571 54856 mT-Sapphire-pBAD tdTomato-pBAD mT-Sapphire (donor) tdTomato (acceptor) FRET...Nathan Shaner , Roger Tsien 54575 54771 Clover-pBAD mRuby2-pBAD Clover (donor) mRuby2 (acceptor) FRET Michael...aTc) Staphylococcus aureus Tim Foster 36267 pBAD33.1 pBAD Arabinose Escherichia coli Christian Raetz 26098...Mycobacterium smegmatis Matthias Wilmanns 84689 pMyBADC-kan pBAD Arabinose Escherichia coli , Mycobacterium smegmatis...Escherichia coli Cynthia Collins 84689 pMyBADC-kan pBAD Arabinose Escherichia coli , Mycobacterium smegmatis...

  6. Fluorescent Proteins 101: Fluorescent Protein Timers

    Type
    Blog Post
    ...2.7/4.7 3.9 h (red) pMedium-FT-N1 pTRE-Medium-FT pBAD/HisB-Medium-FT Slow-FT 402 (blue), 583 (red) ... 2.6/4.6 28 h (red) pSlow-FT-N1 pTRE-Slow-FT pBAD/HisB-Slow-FT -  Applications of fluorescent ...red) 2.8/4.1 7.1 h (red) pFast-FT-N1 pTRE-Fast-FTpBAD/HisB-Fast-FT Medium-FT 401 (blue), 579 (red)...

  7. Fluorescent Proteins: FRET

    Type
    Collection
    ...399 0.64 510 83,000 0.65 4.6 2.6 mTagBFP2-pBAD , sfGFP-pBAD ECFP EYFP 434 0.41 527 67,000 0.67 4.8 1.5...0.85 529 94,000 0.74 5.9 2.6 mTFP1-N1 , mCitrine-pBAD EGFP mCherry 488 0.60 610 72,000 0.22 5.3 1.9 mEGFP-N1...633 62,500 0.40 5.6 3.7 pLSSmOrange-N1 , mKate1.31-pBAD , pLSSmOrange-mKate2 LSSmOrange* mScarlet3 437 0.45...

  9. Plasmids 101: Protein Expression

    Type
    Blog Post
    ...bacterial cells: the pET, pRSET, Gateway pDEST, and pBAD vectors for example. Protein expression from each...

  10. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...the influence of structure on an FP’s properties. pBAD-LSSmCherry1 is a long Stokes shift variant, which... two-photon microscopy using Ti-Sapphire lasers. pBAD-RDSmCherry1 is a red-shifted variant which, with...

  11. Sequencing Primers

    Type
    Guide
    ...Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD promoter Forward pBAD Reverse...GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of...

  13. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...Expression page Bacteria Lac, T7, araBAD, trp mTagBFP2-pBAD - Protein expression vector with C-terminal mTagBFP2... - 3rd gen lentiviral plasmid expressing mCherry pBad-EBFP2 - Bacterial expression of EBFP2 blue fluorescent...
Showing: 1 - 15 of 15 results