Skip to main content

We narrowed to 15 results for: pgk promoter

Showing: 1 - 15 of 15 results
  1. Plasmids 101: Cre-lox

    Type
    Blog Post
    ...examined a number of important plasmid elements – promoters, origins of replication, protein tags, and antibiotic...Regulated Cre expression – placing Cre downstream of promoters that are active only in certain cell or tissue...Cre under a variety of ubiquitous and regulated promoters, and many loxP-containing alleles have also been..., Cre-containing adenovirus (Ad-Cre) or AAV (AAV-pgk-Cre) has been used to successfully introduce Cre ...
  2. Plasmids 101: Knockout/Knock-In Plasmids

    Type
    Blog Post
    ...recombinase. If GFP is under control of an endogenous promoter, you can use expression GFP to track cells participating... physiopathological events to which the chosen promoter responds. You can also use this method to tag ...with GFP, as seen in blue flame plasmid OCT4-eGFP-PGK-Puro from the Jaenisch lab.   Figure 3: A...
  3. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...from the EF-1 promoter pCDH-CB 72267 Express gene of interest from the CB promoter pCDH-PGK 72268 xpress...enhancer pCDH-PGK-Nluc-P2A-copGFP-T2A-Puro 73040 Expresses Nluc and copGFP from the PGK promoter Adenoviral...under from the CB promoter pCDH-CB-iCre 72257 Express iCre under from the CB promoter pCDH-CB-FLPe-P2A-...the CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266 ...xpress gene of interest from the PGK (phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of ...from the CB promoter pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2...
  4. Luciferase Plasmid Collection

    Type
    Collection
    ...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...transfection Feng Zhang 21471 pLenti PGK V5-LUC Neo (w623-2) Firefly PGK Lentiviral expression of firefly ...luciferase Linzhao Cheng 74444 pLenti.PGK.blast-Renilla_Luciferase Renilla PGK Lentiviral expression of Renilla...Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo) Akaluc hPGK Lentiviral expression of Venus-Aka-luciferase...luciferase Mark Kay 140328 pLenti-PGK-Venus-Fluc (puro) Firefly hPGK Lentiviral expression of Venus-firefly...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...Jorge Ferrer 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly...
  5. Recombinases AAV Preps

    Type
    Collection
    ...AAV.rTH.PI.Cre.SV40 rTH none 9, rg* James M. Wilson 24593 AAV-pgk-Cre PGK none rg* Patrick Aebischer 51507 AAV pmSyn1-EBFP-Cre...information about these molecular tools. Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...AAV.TBG.PI.Cre.rBGe TBG none 8 James M. Wilson Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)... Syn none 5, rg* Hongkui Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...Research Program Light-Inducible Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV...EF1a none 1, PHPeB Hongkui Zeng VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre...
  6. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...proteins, a multiple cloning site (MCS), an inducible promoter, and/or a selectable marker. They are frequently...T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter and Hygromiycin resistance marker Also see more...Plasmids and Resources collection page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ... expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC - Vectors from...
  7. Retrograde AAV viral preps

    Type
    Collection
    ... CAG tdTomato Control Loren Looger 24593 AAV-pgk-Cre PGK Cre expression Recombinases Patrick Aebischer...Inhibitors Other Molecular Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP...
  8. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ... trying to pick your perfect promoter! Eukaryotic Promoters   Promoter   Primarily used for RNA     .... In practice, the term "promoter" describes the combination of the promoter (RNA polymerase binding site...recognize and bind to specific promoter elements. This means that the promoter present in your plasmid backbone...RNAP II promoter, whereas small RNAs (such as shRNA) are transcribed from the RNAP III promoters. This ...post on viral vector parts. Promoter specificity Aside from choosing a promoter based on type of RNA transcript...cell types or organisms, promoters must be similarly variable. Bacterial promoters only work in prokaryotic...require unique promoters and there is very little crossover. Generally speaking, promoters in bacteria are...
  9. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of...multiple copies of a transcription factor to a promoter and localization of a protein via the presence...are inserted between the truncated gene and the promoter to prevent leaky expression of this resistance...
  10. Promoters

    Type
    Guide
    ...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...elements, insulators, and silencers. Bacterial Promoters Promoters in bacteria contain two short DNA sequences... binding to the promoter region. Each sigma factor recognizes different core promoter sequences. Figure...
  11. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG... virus (MoMuLV) LTR Forward mPGK-F CATTCTGCACGCTTCAAAAG Mouse PGK promoter Forward MSCV CCCTTGAACCTCCTCGTTCGACC...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG... AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...
  12. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Parmar 234872 PGK-HA-PGRN GRN HA PGK Frontotemporal dementia (FTD) Andrew Arrant 234873 PGK-HA-PGRN-LAMP1TM...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...10880 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR...Parkinson's Niels Gehring 66818 pCCL-PGK-SPdCas9-BFP-DNMT1 DNMT1 PGK Hereditary sensory neuropathy type ...Lippincott-Schwartz 164214 PLEX-PGK-ANXA11-mCerulean ANXA11 mCerulean PGK ALS Jennifer Lippincott-Schwartz...OPTN-P1 OPTN Luciferase PGK ALS Angela Ting 237837 OPTN-P2 OPTN Luciferase PGK ALS Angela Ting 238617 ... Parkinson's, FTD Mark Mayford 35000 Nurr1 NR4A2 PGK Parkinson's Malin Parmar 35217 psen2_L (OZ577) PSEN2...
  13. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...complex in the transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin...10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription for generation...
  14. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid Gene/Insert Selectable...plasmid (Loqué et al., 2007) containing the PMA1 promoter and the URA3 marker, the p415 plasmid (Loqué et... et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km plasmid (Vickers et...
Showing: 1 - 15 of 15 results