Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 3 results for: pgl3-control

Showing: 1 - 3 of 3 results

  1. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...widely used luciferase reporter gene plasmid pGL3 pGL3 luciferase reporter gene plasmids have been ...an effort to obtain even more precise temporal control of gene knockout or activation, the c-terminal ...). This system provides users greater temporal control over CRISPR/Cas9 mediated genome modification and...Optogenetics is a powerful tool that utilizes light to control and monitor individual living cells in order to... allows scientists to spatially and temporally control which genes are turned on or off in a given area...strategy is that each "bit" of information must be controlled independently; that is, the signal to record ...Photoswitchable tools for spatial and temporal control of cell events Three years ago, Brian Kuhlman’s...

  2. Luciferase Plasmid Collection

    Type
    Collection
    ...Cockerill 212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription Debrya...under the control of a CMV promoter is present for normalization. Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase... Plasmid Luciferase Type(s) Description PI 64784 pGL3-Basic-IRES Firefly Insertion of 5' promoter/enhancer...luciferase gene fusions. Renilla luciferase under the control of a CMV promoter is present for normalization ...RapidResponse™ Renilla Vector for investigating regions controlling transcription Pete Stecha 212933 pGL4.82(hRluc...Puro) Renilla Vector for investigating regions controlling transcription Pete Stecha 106292 pLS-SV40-mP-...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization. Modified...

  3. Validated gRNA Sequences

    Type
    Collection
    ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA...
Showing: 1 - 3 of 3 results