Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 20 results for: puc

Showing: 1 - 20 of 20 results

  1. Plasmids 101: Origin of Replication

    Type
    Blog Post
    ...pMB1 ori maintains about 20 copies per cell, while pUC – which differs by only two mutations – will produce...Copy Number+ ori Incompatibility Group Control pUC ~500-700 pMB1 (derivative) A Relaxed pBR322 ~15... (derivative) and F1** A Relaxed pGEM ~300-500 pUC and F1** A Relaxed pCDF ~20-40 CloDF13 (CDF) D...

  5. Sequencing Primers

    Type
    Guide
    ...In lacZ gene M13/pUC Forward CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG...

  8. CRISPR Plasmids - Plants

    Type
    Collection
    ... rice snoRNA U3 BsaI none S. pyogenes Yang 47024 pUC gRNA Shuttle Mt U6.6 inFusion none S. pyogenes Parrott...pICSL01009::AtU6p aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295...

  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Mammalian BamHI/EcoRI none S. pyogenes Hygro Hotta pUC-H1-gRNA 61089 Mammalian BsaI none S. pyogenes Huang...Lourido pRGE31 50929 Plant BsaI none S. pyogenes Yang pUC gRNA Shuttle 47024 Plant inFusion none S. pyogenes... 47108 Mammalian BbsI none S. pyogenes Gersbach pUC57-sgRNA expression vector 51132 Mammalian BsaI none...:AtU6p 46968 Plant BsaI none S. pyogenes Kamoun pUC119-gRNA 52255 Plant PCR template none S. pyogenes ...pHSE401 62201 Plant yes, cut S. pyogenes Hyg Chen pUC57-Simple-gRNA backbone 51306 Xenopus BsaI none S. ...

  12. Plasmids 101: Blue-white Screening

    Type
    Blog Post
    ... White Screening Available at Addgene Are: pUC18 and pUC19 Let’s begin at the beginning. The well-characterized...the α-complementation cloning MCS): pGEM-T, pUC18 and pUC19, and pBluescript are a few common vectors. ...

  13. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...insert in pUCXKT will therefore have resistance to both kanamycin and ampicillin (from the pUC19 backbone...100% cloning efficiency and gene expression. The pUCXKT vector ensures that all screened plasmids contain...resistances, restriction enzymes and plasmid backbones. pUCXKT contains a nonfunctional truncated version of the...expression of this resistance. Unlike previous systems, pUCXKT does not result in a translational fusion of the...restriction site (the MCS has several options) and a pUCX-specific reverse primer containing the missing codons...product is then ligated into the MCS/SacI site in pUCXKT, removing the stop codons during backbone digestion...

  16. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...Rep2 and retrograde capsid Alla Karpova 103005 pUCmini-iCAP-PHP.eB PHP.eB AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 103006 pUCmini-iCAP-PHP.S PHP.S AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 127847 pUCmini-iCAP-PHP.V1 PHP.V1 AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 175004 pUCmini-iCAP-AAV.CAP-B10 B10 AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 175005 pUCmini-iCAP-AAV.CAP-B22 B22 AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 185136 pUCmini-iCAP-AAV.MaCPNS1 MaCPNS1 AAV packaging plasmid ... amplification system Viviana Gradinaru 185137 pUCmini-iCAP-AAV.MaCPNS2 MaCPNS2 AAV packaging plasmid ...

  17. Caltech Systemic Capsids

    Type
    Collection
    ...viral vector preparations were produced with the pUCmini-iCAP-PHP.eB plasmid (Addgene #103005) . Note on...viral vector preparations were produced with the pUCmini-iCAP-PHP.S plasmid (Addgene #103006) . Browse Available...viral vector preparations were produced with the pUCmini-iCAP-PHP.V1 plasmid (Addgene #127847) . Browse ...viral vector preparations were produced with the pUCmini-iCAP-AAV.MaCPNS1 plasmid (Addgene #185136) . Browse...viral vector preparations were produced with the pUCmini-iCAP-AAV.MaCPNS2 plasmid (Addgene #185137) . Browse...viral vector preparations were produced with the pUCmini-iCAP-AAV.CAP-B10 plasmid (Addgene #175004) . Browse...viral vector preparations were produced with the pUCmini-iCAP-AAV.CAP-B22 plasmid (Addgene #175005) . Browse...

  18. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...lab Cas9 species = S. pyogenes (PAM = NGG) 51306 pUC57-Simple-gRNA backbone T7 BsaI In vitro transcription...

  20. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Tolwinski 160436 pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1-Worm ...378-1027 KIF5A Halo CBA ALS Marvin Bentley 134901 pUC19-hAPOE-R-loop APOE T7 Alzheimer's Andrew Deans 137187...
Showing: 1 - 20 of 20 results