Skip to main content

We narrowed to 16 results for: puc

Showing: 1 - 16 of 16 results
  1. Plasmids 101: Origin of Replication

    Type
    Blog Post
    ...pMB1 ori maintains about 20 copies per cell, while pUC – which differs by only two mutations – will produce...Copy Number+ ori Incompatibility Group Control pUC ~500-700 pMB1 (derivative) A Relaxed pBR322 ~15... (derivative) and F1** A Relaxed pGEM ~300-500 pUC and F1** A Relaxed pCDF ~20-40 CloDF13 (CDF) D...
  2. Sequencing Primers

    Type
    Guide
    ...lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG...lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC Reverse AGCGGATAACAATTTCACACAGG...
  3. Plasmids 101: Blue-white Screening

    Type
    Blog Post
    ... White Screening Available at Addgene Are: pUC18 and pUC19 Let’s begin at the beginning. The well-characterized...the α-complementation cloning MCS): pGEM-T, pUC18 and pUC19, and pBluescript are a few common vectors. ...
  4. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...insert in pUCXKT will therefore have resistance to both kanamycin and ampicillin (from the pUC19 backbone...100% cloning efficiency and gene expression. The pUCXKT vector ensures that all screened plasmids contain...resistances, restriction enzymes and plasmid backbones. pUCXKT contains a nonfunctional truncated version of the...expression of this resistance. Unlike previous systems, pUCXKT does not result in a translational fusion of the...restriction site (the MCS has several options) and a pUCX-specific reverse primer containing the missing codons...product is then ligated into the MCS/SacI site in pUCXKT, removing the stop codons during backbone digestion...
  5. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...Rep2 and retrograde capsid Alla Karpova 103005 pUCmini-iCAP-PHP.eB PHP.eB AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 103006 pUCmini-iCAP-PHP.S PHP.S AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 127847 pUCmini-iCAP-PHP.V1 PHP.V1 AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 175004 pUCmini-iCAP-AAV.CAP-B10 B10 AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 175005 pUCmini-iCAP-AAV.CAP-B22 B22 AAV packaging plasmid (non-standard... amplification system Viviana Gradinaru 185136 pUCmini-iCAP-AAV.MaCPNS1 MaCPNS1 AAV packaging plasmid ... amplification system Viviana Gradinaru 185137 pUCmini-iCAP-AAV.MaCPNS2 MaCPNS2 AAV packaging plasmid ...
  6. Caltech Systemic Capsids

    Type
    Collection
    ...viral vector preparations were produced with the pUCmini-iCAP-PHP.eB plasmid (Addgene #103005) . Note on...viral vector preparations were produced with the pUCmini-iCAP-PHP.S plasmid (Addgene #103006) . Browse Available...viral vector preparations were produced with the pUCmini-iCAP-PHP.V1 plasmid (Addgene #127847) . Browse ...viral vector preparations were produced with the pUCmini-iCAP-AAV.MaCPNS1 plasmid (Addgene #185136) . Browse...viral vector preparations were produced with the pUCmini-iCAP-AAV.MaCPNS2 plasmid (Addgene #185137) . Browse...viral vector preparations were produced with the pUCmini-iCAP-AAV.CAP-B10 plasmid (Addgene #175004) . Browse...viral vector preparations were produced with the pUCmini-iCAP-AAV.CAP-B22 plasmid (Addgene #175005) . Browse...
  7. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Tolwinski 160436 pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1-Worm ...378-1027 KIF5A Halo CBA ALS Marvin Bentley 134901 pUC19-hAPOE-R-loop APOE T7 Alzheimer's Andrew Deans 138134...Alzheimer's, ALS Tatyana Shelkovnikova 237684 pUC19_msfGFP-FUS-repair-tempate FUS GFP ALS Denes Hnisz 237685...
Showing: 1 - 16 of 16 results