Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 33 results for: sv40

Clear keywords
Showing: 1 - 20 of 33 results

  1. What the HEK?

    Type
    Blog Post
    ...express the SV40 large T-antigen. This allows them to replicate viral plasmids with the SV40 origin of ...of HEK-293, the most commonly used line expresses SV40 large T antigen and is thus dubbed HEK-293T. Given...

  2. Plasmids 101: Terminators and PolyA signals

    Type
    Blog Post
    ...mRNA and the commonly used mammalian terminators (SV40, hGH, BGH, and rbGlob) include the sequence motif...polyadenylation and termination. Out of those listed, the SV40 late polyA and rbGlob polyA are thought to be more...transcription Polyadenylation: General overview BGH rbGlob SV40 Resources on the Addgene Blog Learn how the Promoter...

  3. Plasmids 101: Mammalian Vectors

    Type
    Blog Post
    ...Epstein–Barr virus (EBV) nuclear antigen 1 (EBNA1) or the SV40 large-T antigen (293E or 293T cells), allow for ...amplification of plasmids containing the viral EBV or SV40 ORIs, respectively. The presence of these viral ...

  9. Plasmids 101: Protein Expression

    Type
    Blog Post
    ...for mammalian expression utilize viral promoters (SV40, CMV, and RSV) for robust expression post-transfection...

  10. Hot Plasmids February 2024

    Type
    Blog Post
    ...Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B) Workflow...

  14. Sequencing Primers

    Type
    Guide
    ... Forward SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter...promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence Reverse T3 GCAATTAACCCTCACTAAAGG... DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse pBABE...

  16. Luciferase Plasmid Collection

    Type
    Collection
    ...-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian expression of firefly luciferase...controlling transcription Pete Stecha 106292 pLS-SV40-mP-Rluc Renilla Insertion of 5' promoter/enhancer...Eric Kowarz 18782 MSCV Luciferase PGK-hygro Firefly SV40 Retroviral expression of firefly luciferase Scott...luciferase William Hahn, David Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly...of firefly luciferase Mark Kay 105532 pAAV.CMV.ffLuciferase.SV40 Firefly CMV AAV expression of firefly...

  17. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...73355 Adeno X shuttle vector with EF1 promoter and SV40 polyA pICPIS-CB 73356 AdenoX shuttle vector with...with chicken-beta actin CMV enhancer promoter SV40 polyA Addgene Resources For more information on lentiviral...

  18. TALEN Plasmids and Kits

    Type
    Collection
    ...47388 and 47389 include a Flag epitope tag and an SV40 NLS at the N terminus, a 152-residue deletion from...amino acids after the repeat domain, and C-terminal SV40 NLS and HA tags. Plasmid 47389 also contains the...

  20. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient expression - Gradia Lab...pGADCg - Gateway yeast expression vector that adds a SV40 NLS Myr Membrane localization pWZL-Neo-Myr-Flag-...
Showing: 1 - 20 of 33 results