... Hanna TEF S. cerevisiae TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim TEF1 S. cerevisiae...

...my career and life where I excel (and thus feel grateful) and identify areas in need of improvement. These... the world solely through logic and adopting a grateful, wonder-filled perspective that recognizes marvel...

...and early summer months. We are also extremely grateful to the grant officers at Fast Grants. We received...were sympathetic to this need, we're incredibly grateful that the Chan Zuckerberg Initiative was able to...

...PMCID: PMC4663986. 2.  A. M. Singh, V. V Adjan Steffey, T. Yeshi, and D. W. Allison, “Gene Editing in ...PMC4686154. 3. A. M. Singh, D. W. Perry, V. V. A. Steffey, K. Miller, and D. W. Allison, “Decoding the Epigenetic...

...60930 pPL5071_TEF1*-Cre_URA3 Cre expressed at low levels mutant TEF2 Yeast Piper 60931 pPL5608_TEF1*-Cre_TRP1... mutant TEF1 Yeast Piper 60932 pPL5606_TEF1*-Cre_ADE2 Cre expressed at low levels mutant TEF1 Yeast Piper...Piper 60933 pPL5628_TEF1*-Cre_MET15 Cre expressed at low levels mutant TEF3 Yeast Piper 61391 pCS2-Cre.zf1...

...knowledge, resources, and new ideas - we're so grateful for your writing, your knowledge, and your time...

...Data Hub is a community-driven project. We are grateful to the scientists who have contributed data so...

...String assembly gRNA cloning (STAgR), developed by Stefan Stricker’s lab, is a single step gRNA multiplexing...

...Email [email protected] if you can help! — Dr Steffanie Strathdee, 🗡️Superbug Slayer 🗡️ (@chngin_the_wrld...

...synthetic biology, and I found myself extremely grateful to my colleague Jason for choosing Simon Singh's...

... greeted with an impromptu speech from ASM CEO Stefano Bertuzzi welcoming us. Then it was time to work...

... 50 ul aliquots in a kit with a huge amount of wasteful packaging.  Turns out, one could make a lifetime...

...stably integrated into HEK293 genome 46922 pSNR52-sgTEF1 Yeast CEN/ARS vector (Ura3) that contains sgRNA...controlled by SNR 52 promoter, targeting endogenous TEF1 promoter 46923 pSNR52-sgTET Yeast CEN/ARS vector...

...Cells GFP oligomerization can lead to misleading artefacts in your experiments. Read this post from Erik ...

... links below: ID Plasmid Description 43802 p414-TEF1p-Cas9-CYC1t A human codon-optimized Cas9 for expression...expression in S. cerevisiae (budding yeast) from the TEF1 promoter 43804 p415-GalL-Cas9-CYC1t A human codon-optimized...

... suggestion of a postdoc, to whom I am forever grateful, I started setting aside 3-5 minutes to sit quietly...

...Figure 1: Result of a blue-white screen. Image from Stefan Walkowski.   Restriction digest Another way ...

...of backbones which drive expression using either TEF1 or GAL1 promoters. These vectors are intended for...

...The first Addgene plasmid deposit from Professor Stefan Hell, who won the 2014 Nobel Prize in Chemistry...

... accomplishing and what more we might do. I am grateful every day for their dedication, flexibility, innovative...