Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 5 results for: tef

Showing: 1 - 5 of 5 results

  1. Validated gRNA Sequences

    Type
    Collection
    ... Hanna TEF S. cerevisiae TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim TEF1 S. cerevisiae...

  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Parkinson's, FTD Stefan Stamm 203366 Tau BA 12->7 I260V MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203367...Parkinson's, FTD Stefan Stamm 203368 Tau BA 12->7 G272V MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203371...Parkinson's, FTD Stefan Stamm 203372 Tau BA 12->7 P301S MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203373...Parkinson's, FTD Stefan Stamm 203374 Tau BA 12->7 S305N MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203375...Parkinson's, FTD Stefan Stamm 203376 Tau BA 12->7 K317M MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203378...Parkinson's, FTD Stefan Stamm 203379 Tau BA 12->7 V363I MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203382...Parkinson's, FTD Stefan Stamm 203383 Tau BA 12->10 N296N MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203384...

  3. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km ...Km plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid...

  4. NETRF

    Type
    Collection
    ...academic researchers around the world. The NETRF is grateful for the generous support of philanthropic individuals...

  5. TALEN Plasmids and Kits

    Type
    Collection
    ...galactose-inducible expression. pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs...
Showing: 1 - 5 of 5 results