Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 3 of 3 results

  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 106093 pFRT_TO_FlagHA_TIA1 TIA1 Flag, HA CMV ALS Thomas Tuschl 106094 pFRT_TO_eGFP_TIA1 TIA1 GFP CMV ...'s Michael J Fox Foundation MJFF 38243 pLJM60-Tia1 TIA1 Flag CMV ALS David Sabatini 38248 pMXs-IP HA-Parkin...CMV ALS Thomas Tuschl 106095 pET28a_TIA1 TIA1 His, T7 T7 ALS Thomas Tuschl 106108 px458_2A_GFP_sgRNA_EIF2AK2...Parkinsonism, early-onset Michael Ward 178149 TIA1_Halo_N_allele TIA1 Halo ALS Michael Ward 178150 ABCA7_Halo_C_allele...

  3. Validated gRNA Sequences

    Type
    Collection
    ...GGGTTGTTACACTCATAAAG 65565 cut S. pyogenes 25849248 Du tia1l D. rerio GGTATGTCGGGAACCTCTCC 42248 cut S. pyogenes...
Showing: 1 - 3 of 3 results