Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 61 - 80 of 102 results

  3. Hot Plasmids - November 2023

    Type
    Blog Post
    ...Andrews, N.P., et al. (2019). A toolbox of IgG subclass-switched recombinant monoclonal antibodies for...

  15. Antibodies 101: Validation

    Type
    Blog Post
    ...antibody that you want to use to look at the subcellular localization of a protein of interest. Conveniently...

  18. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...Protein Resources: Empty Backbones Biosensors Subcellular localization Optogenetics Background Förster ... Constructs to target mTurquoise2 to various subcellular compartments pCEP4CyPet-MAMM Cyan Mammalian Expresses...

  20. Sequencing Primers

    Type
    Guide
    ...Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer...
Showing: 61 - 80 of 102 results