We narrowed to 5 results for: ubc
-
TypeGuide...Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer...
-
Antibody Guide
TypeGuide...antibodies can be isotype-specific or even isotype subclass-specific. This specificity can be used to ensure...Isotype Description Configuration and Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears...should never be stored below 4 °C. Certain isotype subclasses, such as IgG3, aggregate after thawing and therefore...different species of origin, isotypes, and isotype subclasses of a primary antibody, which becomes the limiting...? You may need to buy isotype-specific or even subclass-specific secondary antibodies to allow for differentiation... -
Cloning
TypeGuide...restriction enzyme sites. You can easily move (subclone) any piece of DNA that already has restriction... -
Chemogenetics Guide
TypeGuide...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression... -
Optogenetics Guide
TypeGuide...blue-shifted channelrhodopsin from Platymonas subcordiformis 445 CoChR Channelrhodopsin from Chloromonas...