...Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer...

...antibodies can be isotype-specific or even isotype subclass-specific. This specificity can be used to ensure...Isotype Description Configuration and Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears...should never be stored below 4 °C. Certain isotype subclasses, such as IgG3, aggregate after thawing and therefore...different species of origin, isotypes, and isotype subclasses of a primary antibody, which becomes the limiting...? You may need to buy isotype-specific or even subclass-specific secondary antibodies to allow for differentiation...

...transgenes via increased nuclear export. LTR Subcomponents: U3 R U5 in cis LTR; Long terminal repeats; ...bigger than ∼3kb are packaged less efficiently. Subcomponents: U3; Unique 3'; region at the 3' end of viral...

...possible approaches to using this site include subcloning or appending compatible restriction sites onto... insert of interest using PCR. The process of subcloning consists of digesting the insert of interest ...

...whether the edit was successful. PCR amplification, subcloning and Sanger sequencing (for HDR or NHEJ): Provides...PCR amplification of targeted region from DNA, subcloning into a plasmid, and screening individual clones...

...restriction enzyme sites. You can easily move (subclone) any piece of DNA that already has restriction...

...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression...

...blue-shifted channelrhodopsin from Platymonas subcordiformis 510 CoChR Channelrhodopsin from Chloromonas...