Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 20 results for: xenopus

Clear keywords
Showing: 1 - 20 of 20 results

  1. Five Popular Model Organisms, Part 2

    Type
    Blog Post
    ...and Tol2 transposase induced transgenesis.  Xenopus Xenopus, or frogs, are one of the most popular model... developmental and biomedical research.  Xenopus, aka African frog. Image from Holger Krisp. ...major resource for frog research is The National Xenopus Resource, a breeding facility for X. laevis and...embryogenesis. Addgene has over 600 plasmids that contain Xenopus genes and a tool-kit from the Hamdoun Lab to create... fusions in a multitude of organisms including Xenopus. Overall, the ability for scientists to study human...10.7554/elife.05826 Blum, M., & Ott, T. (2018). Xenopus: An Undervalued Model Organism to Study and Model...

  2. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...in water and on land. Current tools are all for Xenopus (aquatic frogs), but there are few genetic tools... Henry Lab (@EvoEmbryo) September 24, 2018   Xenopus tropicalis (Gary Gorbsky) This is not a new experimental...experimental system, but the Gorbsky Lab is using Xenopus frog cell lines to develop robust methods for frog...

  4. CRISPR Plasmids - Xenopus

    Type
    Collection
    ... CRISPR Xenopus CRISPR Plasmids: Xenopus Cut Resources The following...have been designed for use in Xenopus. CRISPR... CRISPR plasmids have been designed for use in Xenopus. To find emtpy gRNA plasmids, visit Addgene's Empty...Expression Vectors page and search the table for "Xenopus". Cut ID Plasmid Gene/Insert Promoter PI Publication...

  6. CRISPR Plasmids and Resources

    Type
    Collection
    ...designed for use in yeast. Xenopus CRISPR plasmids designed for use in Xenopus . Zebrafish CRISPR plasmids...Drosophila, zebrafish, C. elegans, parasites, and Xenopus. Addgene CRISPR Resources CRISPR Guide : Essential...

  7. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...8CCerulean - Zebrafish/Xenopus/Worm/Sea urchin pCS2+8NCerulean - Zebrafish/Xenopus/Worm/Sea urchin mCerulean...pCS2+8CeGFP - Zebrafish/Xenopus/Worm/Sea urchin pCS2+8NeGFP - Zebrafish/Xenopus/Worm/Sea urchin pKT0128...8CmCitrine - Zebrafish/Xenopus/Worm/Sea urchin pCS2+8NmCitrine - Zebrafish/Xenopus/Worm/Sea urchin pET mCitrine...8CmOrange - Zebrafish/Xenopus/Worm/Sea urchin pCS2+8NmOrange - Zebrafish/Xenopus/Worm/Sea urchin mOrange-N1...8CmCherry - Zebrafish/Xenopus/Worm/Sea urchin pCS2+8NmCherry - Zebrafish/Xenopus/Worm/Sea urchin pET mCherry...Gateway Entry Vector pCS2+/C-Halo , pCS2+/N-Halo - Xenopus Expression pET51b-His-TEV-HaloTag7 - Bacterial ...Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial Expression...

  9. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus Parasite Resources Fully functional Cas enzymes...Selectable Marker PI Publication Return to top Xenopus ID Plasmid Gene/Insert Promoter Selectable Marker...

  11. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ... 5 Å resolution) of the linker histone H1.8 in Xenopus nucleosomes and in complex with its chaperone NPM2...

  12. Sequencing Primers

    Type
    Guide
    ...GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR Reverse XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer...

  13. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...

  15. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...a variety of systems, including Xenopus HA Epitope tag pcDNA3.1-HA - Mammalian expression...Gateway destination vector for mammalian, avian, xenopus, or zebrafish expression GST plasmids made by Addgene...

  16. TALEN Plasmids and Kits

    Type
    Collection
    ...vitro synthesis of TALEN mRNAs. Both 5’ and 3’ Xenopus β-globin UTRs are included in the vector to enhance...

  17. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...

  18. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...Kearns et al., Development. 2014..) CRISPRs for Xenopus! From the lab of Yonglong Chen, pCS2-3xFLAG-NLS-SpCas9...used by Chen and colleagues for genome editing inXenopus tropicalis. (Guo et al., Development. 2014..) ...

  20. Immunology Research Plasmids and Resources

    Type
    Collection
    ...cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) DAND4, MGC119894, MGC119895, MGC96951 CGA...DEFB102, DEFB2, HBD-2, SAP1 DKK1 dickkopf homolog 1 (Xenopus laevis) DKK-1, SK EBI3 Epstein-Barr virus induced...gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) CKTSF1B1, DAND2, DRM, GREMLIN, IHG-2, MGC126660...gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) CKTSF1B2, DAND3, PRDC GRN granulin GEP,...
Showing: 1 - 20 of 20 results