We narrowed to 103 results for: primer
-
TypeBlog PostPublishedApril 6, 2021, 12:30 p.m....suitable for the library in question. We will order primers that can amplify the insert of the library. This...PCR cleanup kit to remove any template DNA and primers. After performing extensive QC on that sample,...
-
Adapting Toehold Switches to Detect Zika Virus
TypeBlog PostPublishedAug. 30, 2016, 2:30 p.m....versions of the toehold switches and amplification primers. This helped make sure that we had a number of ...assay’s capabilities. Specifically this includes primer directed isothermal RNA amplification, new toehold... -
Top Requested Plasmid of 2017 - pMD2.G
TypeBlog PostPublishedJan. 10, 2018, 4:13 p.m....lentivirus in another blog post. If you need a quick primer on how lentiviruses work, check out our lentivirus... -
Adenoviral Vector Production and Troubleshooting
TypeBlog PostPublishedJune 14, 2018, 11:44 a.m....determined by a standard curve of known quantity and primers specific for a viral DNA sequence. *Pro-Tip*: Ad5... Addgene Blog Using virus in your research - a primer for beginners Adenoviral delivery of CRISPR/Cas9... -
Anatomy of a Plasmid Page at Addgene
TypeBlog PostPublishedFeb. 4, 2016, 3:30 p.m.... in their own lab. If depositors have provided primer sequences for use, these are listed. We also provide... provide a link to our list of common primers used for sequencing. Growth in Bacteria: This section describes... -
AAVs CREATed for Gene Delivery to the CNS and PNS
TypeBlog PostPublishedSept. 28, 2017, 2:01 p.m....suitable for PCR amplification using pre-designed primers. By using this library to infect an animal expressing...from the infected animal and use the pre-designed primers to determine which version(s) of the capsid gene... -
PRIDICT: Predicting Efficiencies of Prime Editing Guide RNAs
TypeBlog PostPublishedJune 25, 2024, 1:15 p.m....sequence, and an extension sequence containing a primer binding site and a reverse transcription template...length of the RTT overhang, the GC content of the primer binding site, and many more. Once we had our datasets... -
Harnessing TnpB for Genome Editing: A Compact and Versatile Tool for Your Research
TypeBlog PostPublishedJuly 29, 2025, 1:15 p.m....method of choice. Step 5: Colony Screening Use Primer 92F (5′-cattacgcaattggacgacaac-3′) and Oligo 2 ...sequencing using either 92F or M13R as the sequencing primer. Step 7: Transformation Your confirmed plasmid... -
CRISPR 101: Homology Directed Repair
TypeBlog PostPublishedJan. 26, 2023, 2:15 p.m....for proteins required for strand invasion and a primer for DNA repair synthesis. The ssDNA strand then...invade an intact homologous template to serve as a primer for DNA repair synthesis, ultimately leading to... -
Prime Editing: Adding Precision and Flexibility to CRISPR Editing
TypeBlog PostPublishedJan. 13, 2025, 9:49 p.m....activity, enhance binding between the template and primer binding site, increase processivity, or improve...editor; RTT = reverse transcriptase template; PBS = primer binding site. Image from Doman et al., 2023, under...containing the reverse transcriptase template and primer binding site. If this tail is degraded, the truncated... -
CRISPR/Cas9 FAQs Answered!
TypeBlog PostPublishedMarch 13, 2014, 4:08 p.m...., but couldn't amplify the EMX1 gene using same primer you used in the Science paper (Cong et al., 2013...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse... -
6 Tips for Analyzing and Troubleshooting Sanger Sequencing Results
TypeBlog PostPublishedJune 26, 2014, 2:23 p.m....unresolved and small, so I suggest designing your primer at least 50bp upstream of the sequence of interest... -
Addgene's Top Blog Posts from 2020
TypeBlog PostPublishedDec. 29, 2020, 2:15 p.m....protein databases, DNA sequence manipulation, and primer design. Best wishes for the new year and your ... -
Easi-CRISPR: Generating Knock-In and Conditional Mouse Models
TypeBlog PostPublishedApril 5, 2018, 12:42 p.m....protein), you can amplify the desired region using primers containing the homology arms on both sides and ...repair templates using Addgene plasmids. Design PCR primers to add T7 promoter-left homology arm and right ... -
CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]
TypeBlog PostPublishedFeb. 18, 2015, 3:09 p.m....electroporation, sort your transfected cells via FACS, primer validation, and screening by PCR for biallelic ... -
Tag Your Favorite Yeast Genes with Ease
TypeBlog PostPublishedNov. 19, 2013, 2:37 p.m....been integrated. Simply design your amplification primers with the desired targeting homology—in frame, of... -
Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering
TypeBlog PostPublishedDec. 15, 2016, 3:57 p.m....Substrate dsDNA inserts can be made by PCR using primers that amplify the DNA sequence of interest and flank...the targeted insert site (Figure 2, top). These primers are typically ~70 nucleotides long (20 nucleotides... -
Using Addgene's New Viral Service for Your Research
TypeBlog PostPublishedNov. 17, 2016, 3:30 p.m....the Addgene Blog Using Virus in Your Research: A Primer for Beginners Lentiviral Vector Uses and Overview... -
Plasmids 101: NGS Quality Control for Pooled Libraries
TypeBlog PostPublishedOct. 26, 2017, 1:59 p.m....sequencing (NGS). For gRNA libraries, you’ll design primers to create 200-300 bp sequencing products using ... -
Identifying Sequence Elements with SnapGene's Feature Database
TypeBlog PostPublishedDec. 21, 2017, 2:06 p.m....strategies set experiments back days or even weeks. Primer design was done painstakingly by hand. Records ...