We narrowed to 103 results for: primer

..., J.B. Budding yeast for budding geneticists: A primer on the Saccharomyces cerevisiae model system. Genetics... P.A. An ancient yeast for young geneticists: A primer on the Schizosaccharomyces pombe model system. ...

...suitable for the library in question. We will order primers that can amplify the insert of the library. This...PCR cleanup kit to remove any template DNA and primers.  After performing extensive QC on that sample,...

...lentivirus in another blog post. If you need a quick primer on how lentiviruses work, check out our lentivirus...

... in their own lab.  If depositors have provided primer sequences for use, these are listed.  We also provide... provide a link to our list of common primers used for sequencing. Growth in Bacteria: This section describes...

...determined by a standard curve of known quantity and primers specific for a viral DNA sequence. *Pro-Tip*: Ad5... Addgene Blog Using virus in your research - a primer for beginners Adenoviral delivery of CRISPR/Cas9...

...suitable for PCR amplification using pre-designed primers. By using this library to infect an animal expressing...from the infected animal and use the pre-designed primers to determine which version(s) of the capsid gene...

...sequence, and an extension sequence containing a primer binding site and a reverse transcription template...length of the RTT overhang, the GC content of the primer binding site, and many more. Once we had our datasets...

...for proteins required for strand invasion and a primer for DNA repair synthesis. The ssDNA strand then...invade an intact homologous template to serve as a primer for DNA repair synthesis, ultimately leading to...

...method of choice. Step 5: Colony Screening Use Primer 92F (5′-cattacgcaattggacgacaac-3′) and Oligo 2 ...sequencing using either 92F or M13R as the sequencing primer. Step 7: Transformation Your confirmed plasmid...

...activity, enhance binding between the template and primer binding site, increase processivity, or improve...editor; RTT = reverse transcriptase template; PBS = primer binding site. Image from Doman et al., 2023, under...containing the reverse transcriptase template and primer binding site. If this tail is degraded, the truncated...

..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper (Cong et al., 2013...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...

...unresolved and small, so I suggest designing your primer at least 50bp upstream of the sequence of interest...

...protein databases, DNA sequence manipulation, and primer design. Best wishes for the new year and your ...

...protein), you can amplify the desired region using primers containing the homology arms on both sides and ...repair templates using Addgene plasmids. Design PCR primers to add T7 promoter-left homology arm and right ...

...electroporation, sort your transfected cells via FACS, primer validation, and screening by PCR for biallelic ...

...been integrated. Simply design your amplification primers with the desired targeting homology—in frame, of...

...Substrate dsDNA inserts can be made by PCR using primers that amplify the DNA sequence of interest and flank...the targeted insert site (Figure 2, top).  These primers are typically ~70 nucleotides long (20 nucleotides...

...the Addgene Blog Using Virus in Your Research: A Primer for Beginners Lentiviral Vector Uses and Overview...

...sequencing (NGS). For gRNA libraries, you’ll design primers to create 200-300 bp sequencing products using ...

...strategies set experiments back days or even weeks. Primer design was done painstakingly by hand. Records ...