Skip to main content

We narrowed to 103 results for: primer

Showing: 41 - 60 of 103 results
  1. Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene

    Type
    Blog Post
    Published
    April 6, 2021, 12:30 p.m.
    ...suitable for the library in question. We will order primers that can amplify the insert of the library. This...PCR cleanup kit to remove any template DNA and primers.  After performing extensive QC on that sample,...
  2. Adapting Toehold Switches to Detect Zika Virus

    Type
    Blog Post
    Published
    Aug. 30, 2016, 2:30 p.m.
    ...versions of the toehold switches and amplification primers. This helped make sure that we had a number of ...assay’s capabilities. Specifically this includes primer directed isothermal RNA amplification, new toehold...
  3. Top Requested Plasmid of 2017 - pMD2.G

    Type
    Blog Post
    Published
    Jan. 10, 2018, 4:13 p.m.
    ...lentivirus in another blog post. If you need a quick primer on how lentiviruses work, check out our lentivirus...
  4. Adenoviral Vector Production and Troubleshooting

    Type
    Blog Post
    Published
    June 14, 2018, 11:44 a.m.
    ...determined by a standard curve of known quantity and primers specific for a viral DNA sequence. *Pro-Tip*: Ad5... Addgene Blog Using virus in your research - a primer for beginners Adenoviral delivery of CRISPR/Cas9...
  5. Anatomy of a Plasmid Page at Addgene

    Type
    Blog Post
    Published
    Feb. 4, 2016, 3:30 p.m.
    ... in their own lab.  If depositors have provided primer sequences for use, these are listed.  We also provide... provide a link to our list of common primers used for sequencing. Growth in Bacteria: This section describes...
  6. PRIDICT: Predicting Efficiencies of Prime Editing Guide RNAs

    Type
    Blog Post
    Published
    June 25, 2024, 1:15 p.m.
    ...sequence, and an extension sequence containing a primer binding site and a reverse transcription template...length of the RTT overhang, the GC content of the primer binding site, and many more. Once we had our datasets...
  7. AAVs CREATed for Gene Delivery to the CNS and PNS

    Type
    Blog Post
    Published
    Sept. 28, 2017, 2:01 p.m.
    ...suitable for PCR amplification using pre-designed primers. By using this library to infect an animal expressing...from the infected animal and use the pre-designed primers to determine which version(s) of the capsid gene...
  8. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    Published
    Jan. 26, 2023, 2:15 p.m.
    ...for proteins required for strand invasion and a primer for DNA repair synthesis. The ssDNA strand then...invade an intact homologous template to serve as a primer for DNA repair synthesis, ultimately leading to...
  9. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    Published
    Jan. 13, 2025, 9:49 p.m.
    ...activity, enhance binding between the template and primer binding site, increase processivity, or improve...editor; RTT = reverse transcriptase template; PBS = primer binding site. Image from Doman et al., 2023, under...containing the reverse transcriptase template and primer binding site. If this tail is degraded, the truncated...
  10. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    Published
    March 13, 2014, 4:08 p.m.
    ..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper (Cong et al., 2013...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...
  11. Addgene's Top Blog Posts from 2020

    Type
    Blog Post
    Published
    Dec. 29, 2020, 2:15 p.m.
    ...protein databases, DNA sequence manipulation, and primer design. Best wishes for the new year and your ...
  12. Easi-CRISPR: Generating Knock-In and Conditional Mouse Models

    Type
    Blog Post
    Published
    April 5, 2018, 12:42 p.m.
    ...protein), you can amplify the desired region using primers containing the homology arms on both sides and ...repair templates using Addgene plasmids. Design PCR primers to add T7 promoter-left homology arm and right ...
  13. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    Published
    Nov. 19, 2013, 2:37 p.m.
    ...been integrated. Simply design your amplification primers with the desired targeting homology—in frame, of...
Showing: 41 - 60 of 103 results