We narrowed to 25 results for: GAL
-
TypeCollection...Plasmid Collections Synthetic Biology Algal Synthetic Biology: Algal SynBio Resources SynBio Home Browse...of synthetic biology plasmids for use in algae. Algal Plasmids Search the table by keyword or sort by ...
-
Synthetic Biology - Fungal
TypeCollection...Plasmid Collections Synthetic Biology Fungal Synthetic Biology: Fungal SynBio Resources SynBio Home Browse...of synthetic biology plasmids for use in fungus. Fungal Plasmids Search the table by keyword or sort by... -
Neurodegeneration Plasmid Collection
TypeCollection...TARDBP GAL ALS Aaron Gitler 27465 pDuet TDP-43 Q331K TARDBP GAL ALS Aaron Gitler 27466 pRS426 Gal TDP43...TDP43 TARDBP GAL ALS Aaron Gitler 27467 pRS426 Gal TDP43 GFP TARDBP GFP GAL ALS Aaron Gitler 27468 pRS303...1185 p416 25Q GAL HTT GFP GAL1 Huntington's Susan Lindquist 1186 p416 103Q GAL HTT GFP GAL1 Huntington's...1187 p426 25Q GAL HTT GFP GAL1 Huntington's Susan Lindquist 1188 p426 103Q GAL HTT GFP GAL1 Huntington's...27458 pRS416 Gal TDP43 WT TARDBP GAL1 ALS Aaron Gitler 27459 pRS416 Gal TDP43 G294A TARDBP GAL1 ALS Aaron... pRS416 Gal TDP43 M337V TARDBP GAL1 ALS Aaron Gitler 27461 pRS416 Gal TDP43 Q331K TARDBP GAL1 ALS Aaron...pAG416-Gal-PR50 C9orf72 FLAG, Myc GAL1 ALS Aaron Gitler 84902 pAG416-Gal-PA50 C9orf72 FLAG, Myc GAL1 ALS ... -
Adenovirus Plasmids
TypeCollection...Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb genomic... -
The Pleiades Promoter Project
TypeCollection...Ple80 GABRA6 pEMS1434 EGFP/NLS Ple81 GAL pEMS1177 EGFP/NLS Ple84 GAL pEMS1180 EGFP/NLS Ple85 GCHFR pEMS1122... -
Validated gRNA Sequences
TypeCollection...26355004 Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...23849981 Qi GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC...crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1...TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes... -
Immunology Research Plasmids and Resources
TypeCollection...ODG1 GAL galanin prepropeptide GALN, GLNN, GMAP, MGC40167 GALP galanin-like peptide - GALR2 galanin receptor...receptor 2 GALNR2, MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1, ...PA28 alpha) IFI5111, MGC8628, PA28A, PA28alpha, REGalpha PSME1 proteasome (prosome, macropain) activator...PA28 alpha) IFI5111, MGC8628, PA28A, PA28alpha, REGalpha PSME2 proteasome (prosome, macropain) activator...interferon gamma transducer 1) AF-1, IFGR2, IFNGT1 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte... -
Worm Expression Resources
TypeCollection...promoter. cGAL and Split cGAL plasmids - Paul Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system... -
AAV Packaged on Request
TypeCollection...facilitation for the transfer plasmid, including legal approval and an implementation letter DNA amplification...applicable transfer plasmid. We will help you gain legal usage of the transfer plasmid from the providing...materials, using them in the lab, and even managing legal permissions and distribution. Troubleshooting If... -
TALEN Plasmids and Kits
TypeCollection...-BB contains the GAL1 promoter, placing TALORs built into this vector under galactose-inducible expression...Bogdanove/Voytas) in order to generate TALORs (TAL Orthongal Repressors) that can be used to custom repress... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Golgi apparatus B4GALT1(1-61) mTurquoise2 Dorus Gadella 68073 GalToxBFP Golgi apparatus GalT signal anchor... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4) 21870 pKJ1712... -
Synthetic Biology - Overview
TypeCollection...Organism Bacterial Plant Yeast Mammalian Worm Fungal Algal Featured SynBio Deposits Alper Lab Y. Lipolytica... -
Distribution to Industry
TypeCollection... transfers to for-profit entities. The MTA is a legal agreement between the recipient and the depositing...authorized signatory is someone who can execute legal documents on behalf of the recipient institution... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...blue-white screening and forms blue colonies on LB/Amp/Xgal/IPTG plates — if your insert is successfully cloned... the CMV promoter, forms blue colonies on LB/Amp/Xgal/IPTG plate pAdx-CMV-copGFP 73346 Expresses copGFP... -
Cre-lox system
TypeCollection...optimized for yeast Gal1 Yeast Sandmeyer 26853 pBF3060 Cre codon optimized for yeast Gal1 Yeast Sandmeyer ... pSH62-EBD Cre-EBD - Estradiol-dependent control Gal1 Yeast Gartenberg 50797 pUAS-Cre Cre UAS/Hsp70 Mammalian... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Plant Plasmids and Resources collection page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ... lentiviral gene expression vector URA3 Yeast pAG306GAL-ccdB - Yeast Gateway expression... -
Bacterial Expression Systems
TypeCollection...Plasmids placO with lambda-C1 operator Beta-galactosidase Ann Hochschild Bacterial two-hybrid assay using...Plasmids Sequence chosen by researcher Beta-galactosidase Keith Joung Transcription factor testing: Kit... -
Fluorescent Protein Guide
TypeCollection...from Kurt Thorn and UCSF Molecular Expressions Galleries from Michael Davidson and FSU Spectra Database... -
Antibody Production
TypeCollection..., antibodies undergo a buffer exchange using centrifugal columns. The final formulation buffer is phosphate-buffered...