Skip to main content

We narrowed to 103 results for: Nes

Showing: 1 - 20 of 103 results
  1. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Fluorescent Proteins Empty Backbones Fluorescent Proteins: Empty Backbones Blue/UV Cyan Green Yellow Orange... present. Looking for more empty backbones? Visit our Empty Backbones page or search our complete collection...Explore empty plasmid backbones with different fluorescent tags to create fusion proteins with your gene...list many popular fluorescent proteins and empty backbones for expression and cloning of fusion proteins,...the help of Erik Snapp . Note for all tables: Brightness is the product of exctinction coefficient and...yield divided by 1,000. Note that the effective brightness of a fluorescent protein may vary depending on...Blue/UV Protein Excitation (nm) Emission (nm) Brightness pKa Maturation Structure Plasmids Sirius 355 ...
  2. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Empty backbones are plasmids containing...A selection of Addgene's empty vector backbones curated by species, epitope tags/fusion proteins, function...guide to a selection of Addgene's empty vector backbones. For the most part, we will assume that you want... Host Relevant Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient ...- Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible Expression...Hygromiycin resistance marker Also see more empty backbones on our Plant Plasmids and Resources collection...Protein Common uses Representative Empty Backbones Flag Epitope tag c-Flag pcDNA3 or FLAG-HA-pcDNA3.1...
  3. Brain Initiative Collection

    Type
    Collection
    ...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neurons Yulong Li 123308-AAVrg...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neurons Yulong Li 123309-AAV9...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h in neurons Yulong Li 123309-AAVrg...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h in neurons Yulong Li 123310-AAV9...the genetically-encoded fluorescent norepinephrine(NE) control sensor GRAB_NEmut in neurons Yulong Li 123310...the genetically-encoded fluorescent norepinephrine(NE) control sensor GRAB_NEmut in neurons Yulong Li 125560...combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors...
  4. Retrograde AAV viral preps

    Type
    Collection
    ...Syn genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m Norepinephrine sensor Yulong Li...Syn genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h Norepinephrine sensor Yulong Li...control norepinephrine sensor (does not respond to NE) Norepinephrine sensor Yulong Li 20297 pAAV-EF1a-...serotype to deliver Cre-dependent transgenes in Cre transgenic lines. As part of our standard viral production...dTomato Calcium sensor Jonathan Ting 100853 pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 Syn Cre-dependent jRGECO1a...Calcium Sensor Douglas Kim , GENIE Project 100854 pAAV.Syn.NES-jRGECO1a.WPRE.SV40 Syn jRGECO1a Calcium Sensor...
  5. Zhang Lab CRISPR Page

    Type
    Collection
    ...knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...CRISPR-mediated nucleic acid cleavage. We have harnessed the type II CRISPR nuclease system to facilitate...implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9) nuclease along with the guide RNA...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically..., Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9...
  6. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pcDNA3.1-hSNCA-NE SNCA NE CMV Parkinson's Shu Leong Ho 102363 pcDNA3.1-hNurr1-NE NR4A2 NE CMV Parkinson's...pSIN-PAmCherry-mSNCA-NE SNCA NE EF-1 alpha Parkinson's Shu Leong Ho 102366 pSIN-hSNCA-NE SNCA NE EF-1 alpha Parkinson's...215486 FUW-hSNCA-NE SNCA NE Ubc Parkinson's Ophir Shalem 215487 FUW-hSNCA(D2R)-NE SNCA NE Ubc Parkinson'...Parkinson's Ophir Shalem 215488 FUW-hSNCA(D2E)-NE SNCA NE Ubc Parkinson's Ophir Shalem 215489 FUW-hSNCA-GFP SNCA...APP CMV Alzheimer's Helene Marie 107544 pAAV-AICD-NES-IRES-hrGFP APP V5 CMV Alzheimer's Helene Marie 107548...Alzheimer's, ALS Eran Hornstein 229082 PiggyBac-APEX-V5-NES TARDBP V5, APEX, BFP TRE3G ALS Eran Hornstein 229738...SFFV Parkinson's Denes Hnisz 145270 pHR-TBP(53Q)-IDR-mCherry-Cry2-NLS TBP Parkinson's Denes Hnisz 145283 ...
  7. Biosensor AAV Preps

    Type
    Collection
    ...SF-iGluSnFr Glucose Sensors iGlucoSnFr Norepinephrine (NE) Sensors GRAB_NE nLight Oxytocin (OT) Sensors GRAB_OT...iGlucoSnFr mRuby2 Constitutive 9 Looger Norepinephrine (NE) Sensors 123308 pAAV-hSyn-GRAB_NE1m Syn GRAB_NE1m... Griesbeck Calcium Sensor: jRCaMP1 100846 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 CAG jRCaMP1a none Cre dependent... dependent 1 Kim , GENIE 100848 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Syn jRCaMP1a none Constitutive 1, 9 Kim...Kim , GENIE 100849 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 CAG jRCaMP1b none Cre dependent 1 Kim , GENIE ...GENIE 100850 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Cre dependent 1 Kim , GENIE 100851 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40...CaMPARI none Constitutive 1, 5, 9 Looger 101060 pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40 Syn CaMPARI2 his Constitutive...
  8. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Ryan Mehl 174081 pAcBac1-NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84 tRNA synthetase M. barkeri...growth medium, ncAA concentration, and the cell lines used previously. Remember that the orthogonal pairs...aminoacylate only the orthogonal tRNA, and not endogenous ones. Endogenous synthetases cannot aminoacylate the ...mazei Mammalian TGA Simon Elsaesser 174901 pAS_MmaPylT_EF1_NES-MmaPylRS WT PylRS M. mazei Mammalian TAG ...TAG Simon Elsaesser 174902 pAS_MmaPylT_EF1_NES-MmaPylRS AF PylRS (Y306A, Y384F) M. mazei Mammalian TAG Simon...Thomas Huber 182287 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF) Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA synthetase...TAA Wenshe Liu 182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine...
  9. CRISPR History and Development for Genome Engineering

    Type
    Collection
    .... 25(10):1581-9. PMID: 26355004 Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl... anti-CRISPR genes in bacteriophages infecting Pseudomonas aeruginosa . Anti-CRISPR genes employ varied...system - utilizing various CRISPR-associated (Cas) genes to not only store a record of invading phages but...Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based on shared characteristics...genomic DNA. Type II CRISPR was the first system harnessed for genome engineering, with Type V following ...Csf1) Type VI (Cas13) Fighting Back: Anti-CRISPR Genes in Phage The CRISPR adaptive immune system seems.... Pooled gRNA libraries can be used to identify genes that are important to a given phenotype. Current...
  10. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Li Norepinephrine nLight red and green GPCR-based NE indicators Sensitive multicolor indicators for monitoring...Norepinephrine GRAB_NE family of GPCR activation-based NE sensors A Genetically Encoded Fluorescent Sensor ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...Campbell Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins...proteins Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent...mScarlet-based calcium sensor with exceptional brightness, photostability, and multiplexing capabilities...
  11. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pmTurquoise2-NES Non-nucleus Nuclear Export Sequence mTurquoise2 Dorus Gadella 85062 pmScarlet-i_NES_C1 Non-nucleus...pmScarlet-H_NES_C1 Non-nucleus Nuclear Export Sequence mScarlet-H Dorus Gadella 85060 pmScarlet_NES_C1 Non-...for cloning in our Fluorescent Proteins Empty Backbones Collection ). Then, by examining the overlap between...proteins that enter the secretory pathway require chaperones to help with folding or post-translational modification...
  12. Validated gRNA Sequences

    Type
    Collection
    ...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...
  13. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108...none S. pyogenes Gersbach pUC57-sgRNA expression vector 51132 Mammalian BsaI none S. pyogenes Huang pAC154... yes, activate S. pyogenes Jaenisch pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen...
  14. CRISPR Plasmids - Plants

    Type
    Collection
    ... aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295 pRGEB31...snoRNA U3 BsaI none S. pyogenes Yang 50579 pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen 50580 pBUN6I11...yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen 50594 pCBC-MT2T3... paper BsaI none S. pyogenes Chen 50595 pCBC-MT3T4 see paper BsaI none S. pyogenes Chen 62204 pBUN421 ...TaU3 BsaI yes, cut S. pyogenes Bar Chen 53063 pU3-gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3-gRNA ...gRNA maize U3 none S. pyogenes Gao 53062 pU6-gRNA wheat U6 BbsI none S. pyogenes Gao 59188 pBlu/gRNA Arabidopsis...Arabidopsis U6 BbsI none S. pyogenes Stupar 62200 pBUE411 OsU3 yes, cut S. pyogenes Basta Chen 62203 pHUE411...
  15. CRISPR Guide

    Type
    Collection
    ...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi... and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified. You can therefore...CRISPR was originally employed to knock out target genes in various cell types and organisms, but modifications... ability to selectively activate/repress target genes, purify specific regions of DNA, image DNA in live...Multiplexing applications include editing multiple genes at once; using dual nickases to generate a knockout... used to knock out, activate, or repress target genes when paired with the appropriate Cas enzyme. Specific...CRISPR specificity. SpCas9 (from Streptococcus pyogenes ) is the most popular Cas endonuclease, with many...
  16. Lentiviral Prep Service

    Type
    Collection
    ...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...and 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin... in backbone XPR_502 (P65 HSF) targeting 18,885 genes and containing 56,762 unique sgRNAs. This backbone...
  17. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...AAV-EF1a-BbTagBY Control Joshua Sanes AV-9-PV2454 45186-AAV9 AAV-EF1a-BbChT Control Joshua Sanes AV-9-PV2629 100043...Looger, Eric Schreiter AV-1-PV3844 100855-AAV1 pAAV.CAG.Flex.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas...Douglas Kim AV-1-PV3845 100856-AAV1 pAAV.Syn.Flex.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1...-1-PV3846 100857-AAV1 pAAV.Syn.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3847 100852-...100852-AAV1 pAAV.CAG.Flex.NES-jRGECO1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3848 100853-AAV1 pAAV....Biosensor GENIE, Douglas Kim AV-1-PV3849 100854-AAV1 pAAV.Syn.NES-jRGECO1a.WPRE.SV40 Biosensor GENIE, Douglas ...Douglas Kim AV-1-PV3850 100849-AAV1 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3851...
  18. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Gene Switch: These constructs contain two genes of interest, Genes A and B. When Cre is absent, only Gene...Recombinase Plasmids Recombinase-Dependent Empty Backbones Reporter Plasmids Pooled Libraries/Kits Site-specific...manipulate DNA and control the expression of specific genes in cells or organisms. Each recombinase enzyme recognizes...have adapted these systems to activate/inactivate genes when a recombinase enzyme is present. Read on to... other recombinases , as well as useful empty backbones or reporters . Experimental Considerations Recombinase...orientation, and type of target sites that flox your genes of interest makes FLEx switch a powerful experimental...incorporate appropriate controls such as Cre-only lines to account for cellular toxicity in your system....
  19. Bacterial Expression Systems

    Type
    Collection
    ...Collection Synthetic Biology Plasmids Collection Empty Backbones Collection Molecular Biology Guide CRISPR Guide...periplasmic space between the inner and outer membranes. Targeting proteins to the periplasm reduces bacterial...independently control the expression of up to twelve genes using small-molecule inducers in the same E. coli... Plasmids containing easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins...Bacterial one-hybrid (B1H) systems also use reporter genes to identify interactions between proteins and specific...Promoter activity Fluorescence (GFPmut3a) and luminescence (lux operon) Gram-negative bacteria Attila Karsi... Karsi 14080 pAKlux2 Promoter activity Luminescence (lux operon) Gram-negative bacteria Attila Karsi 14076...
  20. Luciferase Plasmid Collection

    Type
    Collection
    ...luciferase plasmids for gene expression assays and bioluminescent reporters.... Plasmids Luciferase Plasmid Collection Empty Backbones Expression Constructs Reporter Constructs Other...Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent Imaging with Nano-lanterns Promega Plasmid Collection...Collection Luciferase is the enzyme responsible for bioluminescence found in a variety of organisms, ranging from...effects on gene expression can be measured by the luminescence output. The most popular types of luciferase...must be delivered intracellularly to measure luminescence. Gaussia luciferase is secreted and more stable...publication or read our Luciferase blog post . Empty Backbones Browse or search for popular empty backbone plasmids...
Showing: 1 - 20 of 103 results