Skip to main content
Addgene
Showing: 1 - 20 of 41 results
  1. Caltech Systemic Capsids

    Type
    Collection
    ...pAAV-CAG-GFP CAG GFP Control Boyden 50465 pAAV-hSyn-EGFP hSyn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKIIa... 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element GFP, membrane-targeted GFP Control Dimidschstein 192552...pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP Control Gradinaru 105530 pAAV.CMV.PI....CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 99130 pAAV-mDlx-NLS-mRuby2 Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10 These viral vector preparations...
  2. Brain Initiative Collection

    Type
    Collection
    ...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV1 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV2 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV5 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV8 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV9 pAAV-mDlx-GFP-Fishell-1 GFP expression... the control of the mDlx enhancer element Gordon Fishell 83900-AAVrg pAAV-mDlx-GFP-Fishell-1 GFP expression... the control of the mDlx enhancer element Gordon Fishell 83900-PHPeB pAAV-mDlx-GFP-Fishell-1 GFP expression...
  3. Retrograde AAV viral preps

    Type
    Collection
    ...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control Fishell...AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Zeng 50465...50465 pAAV-hSyn-EGFP Syn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKII EGFP Control Roth 114472 pAAV-hSyn-mCherry...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP Syn EGFP...quality control, including AAV titering by SYBR green qPCR , confirmation of the transfer plasmid with PCR...pAAV-hSyn-mCherry Syn mCherry Control Deisseroth 114469 pAAV-CaMKIIa-mCherry CamKII mCherry Control Deisseroth 50459...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth...
  4. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pAAV.GfaABC1D.PI.Lck-GFP.SV40 Control Baljit Khakh AV-5-PV2380 100896-AAV5 pAAV.GFA104.PI.eGFP.WPRE.bGH Control Philip...pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-9-PV0101 105530-AAV9 pAAV.CMV.PI.EGFP.WPRE.bGH Control James ...pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng....SV40 Control Loren Looger AV-1-PV3661 98927-AAV1 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 Control Loren ...pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-2-ALL854 51502-AAV2 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng...pAAV.CMV.LacZ.bGH Control James M. Wilson AV-5-PV1917 105541-AAV5 pENN.AAV.CamKII0.4.eGFP.WPRE.rBG Control James ...pENN.AAV.CMVs.TurboRFP.WPRE.RBG Control James M. Wilson AV-5-PV2213 105547-AAV5 pENN.AAV.EF1a.eGFP.WPRE.rBG Control James M. ...
  5. Control AAV Preps

    Type
    Collection
    ...Packaging Service AAV Controls Viral Vector Packaging Service: Control AAV Browse our control AAV that express...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive...quality AAV preps from select plasmids in the repository. Browse our control AAV collection, including fluorescent...Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 8, 9, rg*, PHPeB, CAP-B10...*, PHP.eB, PHP.S Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894...Browse all Control AAV *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from the...
  6. Tetracycline Inducible Expression

    Type
    Collection
    ...Browse Tetracycline Plasmids Tet-regulated Lentiviral RNAi Vectors Curated Plasmid Collections Background...interest tTA expression plasmid Components for a tetracycline on system are: Plasmid containing a tetracycline-dependent...generation lentiviral plasmid for inducible expression of shRNA; neomycin selection; plasmid 21915 has puromycin...option rtTA On Kowarz 16623 pBI-GFP Expression of your gene of interest & GFP from a bidirectional tet-responsive...and an inducible promoter at its 3' end, which controls GFP expression tTA Off Verma 26803 pEnt L1L3 EF1a-tTA...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...pTet-IRES-EGFP Lentiviral plasmid for inducible expression of transgene of interest and EGFP None Either...
  7. Viral Production

    Type
    Collection
    ...the transfer plasmid, a plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral...Production Titer Quality Control Resources Lentivirus Production Titer Quality Control Resources Overview of... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...subunit (RPP30) as a control for normalization purposes are being used. Quality Control Mycoplasma The 293T... coli . In addition, plasmids are typically prepared using endotoxin-free plasmid purification kits. Resources...Addgene's viral production methods and quality control for lentivirus and AAV. Viral...virus preps are titered and subjected to quality control by Addgene before being distributed to customers...
  8. Lentiviral Prep Service

    Type
    Collection
    ...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV...Pooled Barcoding Libraries Control Addgene's lentiviruses are made from plasmids that are currently in our... list of gRNA plasmids targeting specific genes. For more information on CRISPR plasmids and function,... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...library expresses EGFP for easy visualization via direct fluorescence. Morris Control Lentivirus Browse...our repository. You can obtain the plasmid from us or receive a ready-to-use viral preparation from the...processes. For more information, see our Guide to Plasmid Pooled Libraries . ID Name Description Genes/Insert...
  9. Bacterial Expression Systems

    Type
    Collection
    ... Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids Tagging and Visualization...Visualization Purification Controlled Expression Reporter Plasmids You may also like… Plasmids 101 Addgene's Molecular...interest. Plasmid ID Promoter Inducer(s) PI Purpose Murray Lab pBEST plasmids Various Plasmids pBAD, OR2...Molecular Biology Guides Plasmids 101: E. coli strains for protein expression Plasmids 101: Common Lab E. coli...list of our bacterial CRISPR plasmids, see here . pGRG Series Various Plasmids Tn7 Transposition Nancy Craig...Series Various Plasmids T7-lacO (lactose/IPTG inducible) Flag, His, Strep, mOCR, MBP, GFP, with and without...a variety of plasmids whose expression levels have been well studied or can be controlled by small molecules...
  10. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...pCLIPf-H2B Control Plasmid CLIP-tag Control for nuclear localization 101130 pCLIPf-Cox8A Control Plasmid CLIP-tag...pSNAPf-Cox8A Control Plasmid SNAP-tag Control for mitochondrial localization 101124 pSNAPf-H2B Control Plasmid...SNAP-tag Control for nuclear localization 101123 pSNAPf-ADRβ2 Control Plasmid SNAP-tag Control for cell...CLIP-tag Control for mitochondrial localization 101125 pCLIPf-NK1R Control Plasmid CLIP-tag Control for cell...pMCP-GPI Control Plasmid ACP/MCP-tag Control for cell surface localization 101131 pACP-GPI Control Plasmid...-tag Control for cell surface localization 101128 pACP-ADRβ2 Control Plasmid ACP/MCP-tag Control for cell...Cell-Imaging Plasmid Collection New England Biolabs Cell-Imaging Plasmid Collection Technology Plasmids Supplemental...
  11. Cre-lox system

    Type
    Collection
    ...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral... Plasmid Collections Cre-lox Plasmids Cre-lox Plasmids Additional...iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler...13770 pCALNL-GFP Cre dependent GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch...promoterless CRE-GFP fusion none Mammalian Sauer 11960 pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV...shRNA expression, removal of EGFP; See also similar plasmids pSico PGK GFP and pSico PGK puro Lentiviral...
  12. Serotype Testing AAV

    Type
    Collection
    ...). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in various...These AAV are made from plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG... AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing...37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV in various...These AAV are made from plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human...list of all 100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized... catalog item, including the titer and quality control, visit the material page (linked for each catalog...
  13. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ... Investigator Plasmids GFP GFP-dependent transcription factors Connie Cepko See Plasmids Dronpa Optical...Optical control of protein activity Michael Lin See Plasmids Do you have suggestions for other plasmids that...take advantage of existing GFP-lines for cell-specific manipulation. Plasmids Fluorescent Protein Purpose...Plasmids using a fluorescent protein as a scaffold to allow scientists to selectively modulate gene expression... Plasmid Collections Fluorescent Proteins Activity Regulation Fluorescent Proteins: Activity...Optogenetics Background Fluorescent proteins such as GFP have long been used for labeling, but new methods...regulate a variety of other activities. By using GFP as a scaffold, scientists can design de novo systems...
  14. Optogenetics AAV Preps

    Type
    Collection
    ...soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Boyden 107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...neuroscience to control electrical potentials in neurons. See our Optogenetics Plasmids and Optogenetics...* Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Boyden 100054 pAAV....Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171 pAAV-...Constitutive 8 Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-...dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5, 9, rg* Boyden 137148...
  15. Antibody Production

    Type
    Collection
    ... undergo stringent quality control by Addgene or a trusted quality control partner before distribution... to an untransfected control and the protein size is confirmed. Residual Plasmid Sanger Sequencing Purified... low levels of co-purified plasmid from transfection. This residual plasmid is extracted and amplified...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...embryonic kidney cells are transfected with the plasmid(s) encoding the heavy and light chains. Antibodies...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ...
  16. Luciferase Plasmid Collection

    Type
    Collection
    ...Collections Luciferase Plasmids Luciferase Plasmid Collection You may also like... Fluorescent Proteins Blog...luciferase. Plasmids are Gateway cloning compatible. Learn more about DULIP in our 27 Hot Plasmids from 2016....06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase. Transcriptional...luciferase reporter. These plasmids improve over the original STARR-seq plasmids by using the bacterial ORI...otherwise noted, these plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s...luciferase expression plasmids; these are noted with the viral service icon . ID Plasmid Luciferase Type Promoter.... ID Plasmid Description Gene/Insert PI Return to Top Do you have suggestions for other plasmids that ...
  17. AAV Molecular Tools

    Type
    Collection
    ... These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can be used...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...
  18. Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection

    Type
    Collection
    ... with or without GFP and mCherry controls. Do you have suggestions for other plasmids that should be added... Zhang Lab Plasmids The Human TFome Library Stem Cells Protocols & References MORF Plasmids MORF Pooled...out PCR for 10X scRNA-seq (PDF, 59.2 KB) Plasmids ID Plasmid Gene/Insert Pooled Library The MORF pooled... 1,836 genes encoded by 3,548 isoforms and two control vectors. The individual clones, or the pooled library... added to this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve...
  19. Qi Lab CRISPR Page

    Type
    Collection
    ... CRISPR Qi Lab CRISPR Plasmids Qi Labs CRISPR Plasmids Available from... genome. 1. Two-plasmid CRISPRi system for bacterial gene knockdown The first plasmid ( pdCas9_bacteria... both plasmids in bacteria could cause up to 300-fold repress on targeted genes. 2. Two-plasmid CRISPRi...first plasmid ( pdCas9_humanized ) contains a human codon optimized dcas9 gene under the control of Murine...promoter. The second plasmid ( pgRNA_humanized ) contains a murine U6 promoter controlled sgRNA cassette, ... 23849981 . Individual plasmids can be ordered via the links below: ID Plasmid Description 44246 pdCas9...fusion expression plasmid 44248 pgRNA-humanized A customizable gRNA expression plasmid for use with either...
  20. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...
Showing: 1 - 20 of 41 results