We narrowed to 25 results for: lox
-
TypeCollection...Expression: A stop codon flanked with loxP sites (often called a "lox-STOP-lox" or "LSL" cassette) placed upstream... gene expression to physiological levels. In lox-STOP-lox shRNA constructs, Cre expression promotes shRNA...shRNA Expression: Cre-lox can be used to turn shRNA constructs on or off. In floxed-shRNA constructs, Cre...Learn about Cre-Lox and other site-specific recombinase systems, how to use them to modify the genome... Plasmid Collections Recombinases Cre-Lox and Other Site-Specific Recombinases Cre Plasmids...Site-specific recombinase (SSR) systems, like Cre-lox, derive from fungi or bacteriophages and are powerful...Read on to learn about the different ways that Cre-lox and other site-specific recombinases can be used ...
-
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Expression Vectors page Cre-lox Site-specific recombination See our dedicated Cre-lox Plasmids page pBF3060 ...including plasmids for constitutive, conditional (Cre-lox), or inducible (Tet) expression miRNA and 3' UTR ... -
Plasmid Collections
TypeCollection...Engineering Genome Engineering Overview CRISPR Cre-lox TALENs Zinc Fingers Luminescence Fluorescent Proteins... -
Validated gRNA Sequences
TypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S... -
Mammalian RNAi Tools
TypeCollection...as well as those that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To ... -
E11 Bio PRISM Collection
TypeCollection...at Addgene: AAV Packaged on Request AAV Guide Cre-Lox Plasmid Collection Content last reviewed: 5 September... -
Recombinases AAV Preps
TypeCollection... be used to control gene expression. See our Cre-lox Plasmids page for more information about these molecular... -
Lentivirus Plasmids
TypeCollection...Dmitri Wiederschain 11578 pSico 3rd Conditional (Cre-lox), stable expression of shRNAs; addition of Cre turns... -
Rett Syndrome
TypeCollection... PMID: 35148843 Joost Gribnau Xist 2lox/2lox Conditional Xist, Lox sites flanking exon 1,2,3 C57BL/6 Mouse... -
Deisseroth INTRSECT Collection
TypeCollection...and adding recombinase recognition sequences (e.g. Lox sites, FRT sites) inside of the introns (A,D). The... -
Bacterial Expression Systems
TypeCollection...CRISPR Plasmids and Resources page. Check our Cre-Lox Plasmids Collection for a selection of plasmids containing...Mycobacterium sp. Ashwani Kumar 134405 pBbAW4k-loxP-TT-loxP-mRFP1 Cre recombinase activity Fluorescence ... -
Tetracycline Inducible Expression
TypeCollection...Promoters Mammalian shRNA Plasmids Collection Cre-lox Plasmids Collection Stem Cell Research Plasmids Collection... -
Penn Vector Core Partnership with Addgene
TypeCollection... AV-1-PV2699 100030-AAV1 pAAV.CBA.loxP.ArcLightD.2A.nlsmCherry.loxP.WPRE.SV40 Lawrence Cohen AV-1-PV3509...Svoboda AV-1-20297P 20297-AAV1 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl...Deisseroth AV-1-20298P 20298-AAV1 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA Optogenetics Karl ...Deisseroth AV-5-20297P 20297-AAV5 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl...Deisseroth AV-5-20298P 20298-AAV5 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA Optogenetics Karl ...Svoboda AV-9-20297P 20297-AAV9 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl...Deisseroth AV-9-20298P 20298-AAV9 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA Optogenetics Karl ... -
Optogenetics AAV Preps
TypeCollection...dependent 8 Karl Deisseroth 20297 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA EF1a ChR2/H134R..., 9, rg* Karl Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA EF1a ChR2/H134R EYFP...Flp dependent 8 Karl Deisseroth 20949 pAAV-double floxed-eNpHR-EYFP-WPRE-pA EF1a eNpHR EYFP Cre dependent... -
Retrograde AAV viral preps
TypeCollection...Viviana Gradinaru 112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a Color-flipping switch. Expresses...Norepinephrine sensor Yulong Li 20297 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA EF1a Activator,...Optogenetics Karl Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA EF1a Activator, Cre-dependent... -
Brain Initiative Collection
TypeCollection... Archon1-KGC-GFP-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal...179459-AAV1 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE Double floxed soma and AIS-localized genetically encoded voltage...St-Pierre 179460-AAV1 pAAV-EF1a-DIO-JEDI-2P-WPRE Double floxed genetically encoded voltage indicator (GEVI) JEDI... -
Retrovirus Plasmids
TypeCollection...or screen for GFP. David Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression... -
Control AAV Preps
TypeCollection...Constitutive 5 Chun-Li Zhang 20299 pAAV-EF1a-double floxed-mCherry-WPRE-HGHpA EF1a mCherry Cre dependent 9...PHP.S Edward Boyden 112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a NLS-mCherry or nls-EGFP Cre dependent... -
Zhang Lab CRISPR Page
TypeCollection...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP recombination and fluorescence assisted sorting ...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid facilitates Cre/loxP recombination and fluorescence assisted sorting ... -
Genetic Code Expansion
TypeCollection...Mut1-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...Mut2-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...