Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 105 results for: tro

Showing: 31 - 60 of 105 results

  1. Plan Your Experiment

    Type
    Collection
    ...CRISPR Experiment Jump To: Plan Your Experiment Introduction Select Genetic Manipulation Design and Clone...CRISPR experiments and can be used as positive controls when working out a new protocol. Read more about...generally perform by chemical transfection or electroporation. Expression can be transient, or you can generate... of Cas and gRNA. This method involves using in vitro transcription reactions to generate mature Cas mRNA... to target cells through microinjection or electroporation. The target cells translate the mRNA encoding...you directly combine purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You...delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach. Similar to the mRNA...

  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14666 pQE9-His-p97...T7 Parkinson's Dmytro Yushchenko 107293 s2. pT7-7-SNCA-5Asp SNCA T7 Parkinson's Dmytro Yushchenko 107294... T7 Parkinson's Dmytro Yushchenko 107295 r. pT7-7-SNCA-5Asn SNCA T7 Parkinson's Dmytro Yushchenko 107296...T7 Parkinson's Dmytro Yushchenko 107297 r-22. pT7-7-SNCA-9Asn SNCA T7 Parkinson's Dmytro Yushchenko 107425...neuroaxonal dystrophy Michael Ward 178167 RNF216_Halo_C_allele RNF216 Halo Hypogonadotropic hypogonadism...Ataxia Pietro De Camilli 194005 VPS13D1-1576-(Y1253S) VPS13D GFP CMV Spinocerebellar Ataxia Pietro De Camilli...research related to Alzheimer's Disease (AD), Amyotrophic Lateral Sclerosis (ALS), Frontotemporal dementia...

  3. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...test the function of your gene of interest in a controlled environment under various conditions. When choosing...tag for mammalian expression (Gateway) pYIC - Bicistronic fluorescent reporter gene with cap-dependent ...expression, see our dedicated Lentiviral Plasmids page Retroviral Easy and safe to use, integrate into host genome...MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable... production AAV-GfaABC1D-MCS--4x6T-WPRE - For astrocyte-selective expression in AAV Dual promoter Separate...transient expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP...

  4. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... 10 6 cells in 100 μl of electroporation solution and add to electroporation cuvette. Add 5 μg of each...construct. Electroporate cells with 250 volts for 5 msec in a 2 mm cuvette using an electroporation system...of culture media after electroporation. Minimize the time between electroporation and transferring the ...manuscript here: Bauer et al, 2014 322.2 KB If you have trouble loading this video, please try viewing on YouTube...involves the delivery of CRISPR/Cas9 plasmids by electroporation 4 . This protocol is described in detail for...Li D, Li J. Cell Stem Cell . 2013. PubMed . Electroporation: theory and methods, perspectives for drug ...

  5. Validated gRNA Sequences

    Type
    Collection
    ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

  6. AAV Viral Preps

    Type
    Collection
    ...samples of control AAV vectors for trial purposes in serotypes AAV1, 2, 5, 6, 8, 9, 11, and retrograde Retrograde...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy .... Addgene’s comprehensive high-quality quality control process includes titering, purity assessment, sterility... Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster, Brainbow...

  7. Zebrafish Plasmid Collection

    Type
    Collection
    ...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...horizontal stripes on the sides of the adult body, is a tropical freshwater fish in the minnow family. It has long...refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology or the zebrafish CRISPR...ALS-linked aggregates in real time. Live imaging of astroctyes - Kelly Monk Lab. Live imaging tools to study...study the development and function of zebrafish astrocytes. Knock-in tagging - Michel Bagnat lab. Targeting...

  8. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...intracerebroventricular (ICV) delivery in newborns, and retro-orbital (RO) and stereotaxic (STX) delivery in adult...minBG-SYFP2-WPRE3-BGHpA AiP14470 AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531...minBG-SYFP2-WPRE3-BGHpA AiP12558 AiE0390m_3xC2 SYFP2 Astrocytes Whole Brain 208163 pAAV-AiE0390m_3xC2-minBG-iCre...-iCre(R297T)-BGHpA AiP14801 AiE0390m_3xC2 Cre Astrocytes Whole Brain 208143 pAAV-AiE0390h_3xC2-minBG-SYFP2...minBG-SYFP2-WPRE3-BGHpA AiP13572 AiE0390h_3xC2 SYFP2 Astrocytes Whole Brain 208133 pAAV-AiE0387m-minBglobin-SYFP2...-SYFP2-WPRE3-BGHpA AiP12102 AiE0387m SYFP2 Astrocytes Whole Brain 208166 pAAV-AiE0387m-minBG-iCre(R297T...R297T)-BGHpA AiP13999 AiE0387m Cre Astrocytes Whole Brain 220643 pAAV-AiE2128m-minBG-SYFP2-WPRE3-BGHpA AiP1357...

  9. TALEN Plasmids and Kits

    Type
    Collection
    ...expression is driven by the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7...promoter. RCIscript-GoldyTALEN is designed for in vitro synthesis of TALEN mRNAs. Both 5’ and 3’ Xenopus...of the DNA-binding domain of a TALE, along with strong nuclear localisation tags and repress transcription... T7 promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which ... included for generating TALEN mRNAs through in vitro transcription as an alternative. Based on transient...

  10. Neurodegeneration Research Collection

    Type
    Collection
    ...collections available at Addgene. Amyotrophic Lateral Sclerosis Amyotrophic lateral sclerosis (ALS), sometimes...being adopted in the field. Read on for a brief introduction to the genetics associated with some of the ...Symptoms include changes in behavior and emotion, uncontrolled movements, memory deficits, as well as difficulty...neurons in the substantia nigra, one of the movement control centers in the brain. The cause of this neuron ...Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base edit human...

  11. Optogenetics Plasmid Collection

    Type
    Collection
    ...Optogenetics plasmids encode proteins that are controlled by light. Many of these plasmids encode for microbial...the cell. When using these opsins as a tool to control neuronal activity, scientists generally attach ...localization. Many other types of proteins can also be controlled by light, generally by utilizing a light sensitive...fusions can then be used as an optical switch to control protein interactions, dimerization, localization...the table below for plasmids that use light to control a protein or cellular activity. For example, search...

  12. CRISPR Plasmids - C. elegans

    Type
    Collection
    ... In vitro transcription none, need Cas9 plasmid Boxem 47912 SP6-sgRNA-scaffold SP6 AflII In vitro transcription... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...R07E5.16 U6 yes, cut Goldstein 42250 DR274 T7 BsaI In vitro transcription none, need Cas9 plasmid Joung 46170...

  13. AAV for Neuronal Tracing

    Type
    Collection
    ...viral service encoding tools for monosynpatic retrograde neuronal tracing, to be used with modified rabies...be used with modified rabies virus to perform retrograde neuronal tracing. Note : Addgene does not distribute... pAAV-TREtight-mTagBFP2-B19G AAV1 Wickersham Introduction to Rabies Virus-based Monosynaptic Tracing The...-deleted rabies to specific starter cells, the tropism of this virus was modified so that it could only..., Finke S, Conzelmann KK, Callaway EM. 2007a. Retrograde neuronal tracing with a deletion-mutant rabies...

  14. CRISPR References and Information

    Type
    Collection
    ...wide range of organims. Developed by the Michael Boutros Lab . CasFinder: Flexible algorithm for identifying...107 KB Chen and Wente Zebrafish: gRNA cloning, in vitro transcription, injection gRNA core ; Cas9 ; optimized...Fujii gRNA design and cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP)... packaging plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library...lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for...

  15. Optogenetics AAV Preps

    Type
    Collection
    ... Optogenetics AAV *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from the Karpova...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...Optogenetics is typically used in neuroscience to control electrical potentials in neurons. See our Optogenetics...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Don’t See What You’re Looking For? ...

  16. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Mammalian/in vitro transcription BsaI none S. pyogenes Mark pU6T7 71462 Mammalian/in vitro transcription...pyogenes Luikart pRubiG-T2A-Cas9 75348 Mammalian/Retroviral from pXL yes, activate S. pyogenes EGFP Luikart...Luikart pRubiC-T2A-Cas9 75347 Mammalian/Retroviral from pXL yes, activate S. pyogenes mCherry Luikart pDECKO_mCherry...Gateway recombination-based cloning of complex polycistronic lentiviruses. Can express Cas9 with up to 3 ...in a single vector. sgRNAs are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG ...

  17. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...Cut Fully functional Cas9 enzymes designed to introduce a double-strand break (DSBs) at a specific location...high homology to the DNA surrounding the DSB is introduced along with the Cas9 and gRNA plasmids, the cell...error-prone than NHEJ and can be used to faithfully introduce specific genomic changes. ID Plasmid Gene/Insert...NGG) 51306 pUC57-Simple-gRNA backbone T7 BsaI In vitro transcription none, need Cas9 plasmid Chen Do you...

  18. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ...BsmBI In vitro transcription none, need Cas9 plasmid Chen and Wente 42250 DR274 T7 BsaI In vitro transcription... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...

  19. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... store a record of invading phages but also to destroy the phages upon re-exposure. More specifically,...complex binds to the foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview...could be programmed for targeted DNA cleavage in vitro. In 2013, Cong et al. and Mali et al. described ...therapeutic applications. Despite the ethical controversies surrounding non-research applications, it’s ...Weissman JS. 2014. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell . 159(3...

  20. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...HIV-based lentiviral particles Murine leukemia-based retroviral particles Vesicular stomatitis virus particles...Description Mutations Industry PI Due to export control regulations, MERS and SARS-CoV materials are available...Lentiviral Envelope and Packaging Plasmids Popular γ-Retrovirus Envelope and Packaging Plasmids Reporter Plasmids...vector expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing firefly luciferase...

  21. Recombinases AAV Preps

    Type
    Collection
    ...8, rg* Deisseroth *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from the Karpova...site-specific recombinases, which can be used to control gene expression. See our Cre-lox Plasmids page ...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Don’t See What You’re Looking For? ...

  22. CRISPR Plasmids - Yeast

    Type
    Collection
    ... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in DNA instead...mutants can also be used with a repair template to introduce specific edits via homology-directed repair (HDR...

  23. Chemogenetics AAV Preps

    Type
    Collection
    ...filtering options. *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from the Karpova... dependent) Serotype AAV1 AAV2 AAV5 AAV8 AAV9 Retrograde AAV PHPeB Clear Filters ID Name Receptor and ...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Browse all Chemogenetics AAV Don’t ...

  24. Microbiology Resources

    Type
    Collection
    ... cerevisiae - Dueber Lab Yeast Prototrophy : Restoration of prototrophy in common S. cerevisiae lab strains...Methanococcus maripaludis Methanothermobacter thermautotrophicus Sulfolobus islandicus Plasmids for Bacteria...Resources Read our CRISPR Guide for a general introduction to CRISPR technology. Check out our CRISPR reference...

  25. Plant Plasmids and Resources

    Type
    Collection
    ...includes a high efficiency intron-optimized SpCas9-coding gene, zCas9i, and an intronized Cas9 series of vectors...refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology or the Plant CRISPR Resources... and experimental resources that relate to the control of gene expression in the grasses. OpenPlant Synthetic...

  26. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in DNA instead...mutants can also be used with a repair template to introduce specific edits via homology-directed repair (HDR...

  27. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in DNA instead...mutants can also be used with a repair template to introduce specific edits via homology-directed repair (HDR...

  28. CRISPR Plasmids - Plants

    Type
    Collection
    ... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in DNA instead...mutants can also be used with a repair template to introduce specific edits via homology-directed repair (HDR...

  29. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ... vectors undergo quality control, including AAV titration by ddPCR, in vitro and (when possible) in vivo...chloride, 20 mM Tris at pH 8.0) Suitable for in vitro as well as in vivo delivery where the vector is ...pTR-UF11 chimeric CMV/Chicken Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F...

  30. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...phosphoserine in >36,000 phosphosites by tandem mass spectrometry (Barber et al, Nat. Biotech. 2018). This phosphosite...supD tRNA ( 68307 ) at the central position. Introducing Hi-P for screening phosphorylation-dependent ...interactions. The phosphosite DNA library can also be introduced into a second expression vector encoding a split...human substrates of kinases of interest by mass spectrometry in a technique called serine-oriented library...
Showing: 31 - 60 of 105 results