Skip to main content

We narrowed to 112 results for: LIS;

Showing: 21 - 40 of 112 results
  1. Antibody Guide

    Type
    Collection
    ...two most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein ...expression and assay efficacy. ELISA Enzyme-linked immunosorbent assay (ELISA) is a plate-based assay that...differentiate between proteins. HRP is also used in ELISAs, which only measure a single antibody signal. Here...relative amounts of protein. Includes: Western blot ELISA Capture - used to isolate specific proteins or protein...Quantification methods, such as western blots or ELISAs, are used to quantify relative amounts of protein...standard curves to quantify exact amounts of proteins. ELISAs quantify a single protein per assay and typically...signaling molecule. Figure 4: A direct sandwich ELISA, which uses a capture antibody and a primary conjugated...
  2. TALEN Plasmids and Kits

    Type
    Collection
    ...List of plasmid kits and accessory plasmids available from Addgene for generating your own specific TALE...pC-GoldyTALEN Golden Gate TALEN 2.0 36033 pTAL5-BB Tom Ellis Plasmids pTAL5-BB and pTAL6-BB are designed as alternative... domain of a TALE, along with strong nuclear localisation tags and repress transcription initiation when...the pTAL3 TALEN backbone, which were initially published by Sangamo BioSciences (N153AA, C63AA) and showed...improved, truncated TALE backbone architecture as established by Miller et al. (PMID: 21179091), as well as...regulation of nearby gene expression. The vectors listed below have the EF1α promoter for efficient mammalian... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  3. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...Please note that the following table lists both published and unpublished plasmids containing gRNA sequences... Design Tools CRISPR Blog Posts The table below lists gRNA plasmids designed to target various genes or...deposit process and have your plasmids added to the list. You can also email [email protected] for more information... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  4. Rett Syndrome

    Type
    Collection
    ...Mouse line with conditional deletion of Xist Unpublished Joost Gribnau Human Cell Line Models Induced ....806delG 806delG G269Afs*20 M Fibroblasts & iPSC Unpublished (Link opens in a new window) Wendy Gold A140V...A140V C419T A140V M Fibroblasts Unpublished (Link opens in a new window) Wendy Gold AN_BU 808delC Arg270Glufs...Arg270Glufs*19 F Fibroblasts & iPSC Unpublished (Link opens in a new window) Wendy Gold BO_DI 806delG G269Afs...G269Afs*20 F Fibroblasts Unpublished (Link opens in a new window) Wendy Gold HO_AN G917A R306H F Fibroblasts...Fibroblasts Unpublished (Link opens in a new window) Wendy Gold For more information on generating iPSCs using...Link opens in a new window) ClinicalTrials.gov - a list of Rett syndrome clinical trials (Link opens in ...
  5. Synthetic Biology - Overview

    Type
    Collection
    ...George Church Cynthia Collins James Collins Tom Ellis Drew Endy Tobias Erb Susan Golden John Gray Jeff...Maharbiz Thorsten Mascher Kathleen Matthews Anastasios Melis Aindrila Mukhopadhyay Richard Murray Erin O'Shea..., integration, reporter, and tagging vectors. Metabolism Browse plasmids related to metabolic pathways... Circuit Transfer C. Collins Lab Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  6. Microbiology Resources

    Type
    Collection
    ...for specific genes or applications that are not listed here. Addgene Microbiology Resources Plasmid Kits...sp. Haemophilus influenzae Helicobacter pylori Listeria monocytogenes Mycobacterium sp. Neisseria sp. ...West Nile virus (WNV) Zika Don’t see your field listed? Know of some great plasmid tools for the community...Heterologous protein expression in E. coli, B. subtilis and P. pastoris - Gomis-Rüth Lab pOSIP plasmid... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  7. Arf GTPase Family

    Type
    Collection
    ...ARF GTPase Plasmids by Gene The following table lists genes in the ARF GTPase family, information on each...available for each gene. Click the gene name for a full list of plasmids available. Please note that some genes...GAP and GEF Plasmids by Gene The following table lists genes in the ARF GAP and GEF family, information... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  8. Plasmids for Stem Cell Research

    Type
    Collection
    ...expression of human L-Myc, Lin28, Sox2, Klf4, Oct3/4, Glis1, and EBNA1 from separate plasmids An Efficient Non-viral...from three separate plasmids A Facile Method to Establish Human Induced Pluripotent Stem Cells From Adult...expressing human Oct4, Klf4, Sox2, with either c-Myc or Glis1 Efficient generation of human iPSCs by a synthetic...differentiation of iPSCs into cortical and motor neurons. Unpublished. Ward Glial Progenitor Cells GABAergic Interneurons... Research Plasmids This table contains a general list of plasmids that have been used in Stem Cell research... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  9. Fluorescent Proteins: FRET

    Type
    Collection
    ...molecules, and more. Popular FRET Pairs This table lists some popular fluorescent proteins used as FRET pairs...with their properties. Where available, we have listed cloning backbones and control plasmids. Donor Acceptor...designing your experiment, be sure to refer to published reports and include appropriate controls to help...Calibration Standards The articles or collections listed below feature plasmids with positive and negative...controls for many FRET pairs Michael Davidson Lab (Unpublished) FRET Indicators - Live and Fixed Cells Additional...
  10. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...A list of zebrafish genes and associated pairs of zinc finger arrays that can be used to generate ZFNs... for Endogenous Zebrafish Gene Targets Recent published reports have shown that engineered zinc finger...targeted to various zebrafish genes. The table below lists zebrafish genes and associated pairs of zinc finger...details). IMPORTANT NOTE: All zinc finger arrays listed show transcriptional activation activity of three-fold...
  11. Worm Expression Resources

    Type
    Collection
    ... not included in this table. For a more complete list of plasmids that can be used in worms, search Addgene's...Plasmids Expressing Worm Genes/Inserts The table below lists plasmids that contain a worm ( C. elegans, C. briggsae...: ID Plasmid Gene/Insert PI Don’t see your gene listed? Know of some great plasmid tools for the community... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  12. Zebrafish Plasmid Collection

    Type
    Collection
    ... fish in the minnow family. It has long been established as a powerful vertebrate model organism for the... Tracing during Development and Regeneration - Periklis Pantazis Lab Multibow: digital spectral barcodes...optogenetics to tools for studying diseases, are listed below: Lipid droplet reporters - Richard White ... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  13. Ras Pathway

    Type
    Collection
    ...Pathway Background Ras Pathway Plasmids Ras Gene List Resources Background Ras is a small GTPase and is...available plasmids for the gene, or browse the gene list below. For proteins with multiple subunits or isoforms...Cancer Research Return to top Ras Pathway - Gene List Click on a name to find available plasmids for the... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  14. Validated gRNA Sequences

    Type
    Collection
    ... Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have been experimentally validated...experiment as described in the associated article (listed below by PubMed ID). These factors include: Does...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...
  15. Synthetic Biology - Browse Plasmids

    Type
    Collection
    ...A list of Addgene plasmids for use in synthetic biology applications, or from synthetic biology labs....Standards SynBio Blog Genome Engineering Browse the list of available plasmids related to synthetic biology...are plasmids you would like to see added to this list, please email [email protected] . Synthetic Biology...
  16. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...present in many circulating variants. The table below lists expression plasmids that are suitable for generating...measuring infectivity and neutralizing activity are listed below: ID Plasmid Description PI 44965 NL4-3 mCherry... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  17. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...partnership to provide AAV viral preps, includes listing of transfer status for viral preps....vectors for distribution via Addgene. For a full list of Addgene's viral vectors See Addgene's Current...some viral vectors have been discontinued. See the list of discontinued viral vectors . The following vectors...information. Plasmids are available for all the items listed below. Please let us know (Link opens in a new ...
  18. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...Packaging Plasmids The following tables contain a list of packaging plasmids that are useful to produce...Mutations PI AAV Plasmids This table contains a general list of plasmids that encode the AAV genome (i.e., the... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  19. TALEN Guide

    Type
    Collection
    ...CRISPR Plasmids Zinc Finger Consortium Originally published in Addgene's December 2011 Newsletter Overview...Halle-Wittenberg and Adam Bogdanove at Iowa State University published the nucleotide recognition code of the TAL effectors... before the end of the year. Dr. Zhang ‘s lab published a paper on TAL effectors in Nature Biotechnology...
  20. Lentiviral Prep Service

    Type
    Collection
    ... for in vivo use. Volume and minimum titers are listed on each item's material page. Actual titers are...targeting sequences. Browse our repository for a list of gRNA plasmids targeting specific genes. For more...fluorescence. Morris Control Lentivirus Browse our list of available viruses based on plasmids in our repository...
Showing: 21 - 40 of 112 results