We narrowed to 84 results for: Mpl;
-
TypeCollection...Collection INTRSECT Plasmid Collection INTRSECT Implementation Plasmids References The development of powerful...populations defined by multiple parameters. Figure 1: Examples of intersectional cell population definitions ...order to enable three-feature cell targeting. C) Example of viral targeting of cells expressing Cre AND ...producing a functional molecular tool (C,F). Implementation The following resources may be of interest ...interest for groups interesting in implementing intersectional experimental design. The Deisseroth Lab maintains...
-
Luciferase Plasmid Collection
TypeCollection...Firefly luciferase fragment for split-luciferase complementation assay in plants using Gateway cloning. Use ...Fifrefly luciferase fragment for split-luciferase complementation assay in plants using Gateway cloning. Use ...-RLuc Renilla CAG Vector for packaging self-complementary AAV expressing Renilla luciferase Mark Kay 140328...deep-learning approaches. Split Luciferase Complementation assays can report on protein-protein interactions... : Constructs for split firefly luciferase complementation assays in plants. Bioluminescence Resonance... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...parts can be combined to construct complex networks. This is accomplished through the use of assembly standards...meaning that the suffix will need to be reverse complimented for primer design. The restriction enzymes used...encodes Gly-Ser in-frame with prefix start codon; Employs high-efficiency enzymes. Prohibited Restriction... -
AAV for Neuronal Tracing
TypeCollection...pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies virus AAV1 Ian Wickersham...pAAV-syn-FLEX-splitTVA-EGFP-tTA These AAV together can be used to complement deletion-mutant rabies virus AAV1 Ian Wickersham...lacks the ability to infect neighboring cells. For example, G-deleted rabies lacks the viral glycoprotein...infect any neighboring cells. Thus, through complementation, G-deleted rabies virus can spread to monosynaptically... -
CRISPR Plasmids - Drosophila
TypeCollection...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication... -
Antibody Plasmid Collection
TypeCollection...microscope, or detect when the protein is present in a sample — just to name a few. Traditional sources of antibodies...individual clone targeting a single antigen. An example of R-mAbs is the NeuroMab collection — monoclonal...single-domain antibodies (also known as nanobodies). For example, scientists often use plasmids encoding scFv fragments...recombinant antibody fragments in the form of scFvs A simple vector system to improve performance and utilisation... -
Distribution to Industry
TypeCollection...Insert PI Kits Kit name Type PI Description High Complexity Golden Gate Assembly Standards Kit Cloning Eric...allowed to use for distribution. Please see the Sample Agreements on our Technology Transfer Information...Scientist Acknowledgement (RSA). This form can be completed electronically by the scientist who will be using...using the materials in the order. After the RSA is complete, Addgene will send you a copy of the MTA, which... -
Promega Plasmid Collection
TypeCollection...help advance science while reducing operational complexity. This unique collection contains plasmids developed... below to find plasmids in the collection. For example, search by response element, reporter, protein,...Link opens in a new window) is a structural complementation reporter system composed of a Large BiT (LgBiT...LgBiT; 18 kDa) subunit and a small complementary peptide, Small BiT (SmBiT; 11 amino acids). This system... -
CRISPR Plasmids - Bacteria
TypeCollection...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication... -
TALEN Guide
TypeCollection...Figure 2: Simplified representation of the Voytas/Bogdanove Golden Gate TALEN kit. In this example, the final...bind adenenine with lower specificity). With the template for studying this type of technology already laid... bp. TAL effectors have some restrictions (for example, the target must start with a T), but they still... -
Arf GTPase Family
TypeCollection...ARF GTPase family, information on each gene, and examples of plasmid types available for each gene. Click...request. Family Gene Entrez Gene ID Length (aa) Example Expression Systems GTPase Arf1 375 181 Bacterial... and GEF family, information on each gene, and examples of plasmid types available for each gene. Click...request. Family Gene Entrez Gene ID Length (aa) Example Expression Systems GAP Arfgap1 (ARF1GAP) 55738 ... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...techniques, including that it is easy to implement due to the simplicity of gRNA design, programmable for different...copies of labeled proteins to the given region. For example, chromosome-specific repetitive loci can be efficiently... -
Viral Prep Service for Plasmids and Pooled Libraries
TypeCollection...cited in publications. All pricing includes DNA amplification, viral vector production, purification, and ...Our production process and quality control, with examples of quality control data. Help Center Articles ...will also include virus-associated DNA, which is a sample of the purified DNA from the original plasmid that... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex, comprised of a combination of ...difficulties in getting all components of the Cascade complex to express equally. To combat this, some CRISPR-Cas3... -
CRISPR Plasmids - Yeast
TypeCollection...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed... -
Worm Expression Resources
TypeCollection...below and not included in this table. For a more complete list of plasmids that can be used in worms, search...backbones, and constructs for endogenous tagging. Some examples of useful worm CRISPR resources, along with links...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection... -
Validated gRNA Sequences
TypeCollection...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...and restores visual function in a mouse model of complete congenital stationary night blindness. Hum Mol...Strategies for Overcoming Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495.... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...S. pyogenes Kamoun pUC119-gRNA 52255 Plant PCR template none S. pyogenes Sheen pRGEB31 51295 Plant BsaI...62201 Plant yes, cut S. pyogenes Hyg Chen pUC57-Simple-gRNA backbone 51306 Xenopus BsaI none S. pyogenes...Bacteria BsaI yes, activate S. pyogenes Marraffini pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) 47868 Mammalian...MultiSite Gateway recombination-based cloning of complex polycistronic lentiviruses. Can express Cas9 with... -
Neurodegeneration Research Collection
TypeCollection...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority...variation and lifestyle or environmental factors. For example, variations of Apolipoprotein E (APOE), such as...collection of neurological mouse models including complex and monogenic diseases. Alzforum (Link opens in...