Skip to main content
Addgene

We narrowed to 154 results for: TOR;

Showing: 21 - 40 of 154 results
  1. Retrograde AAV viral preps

    Type
    Collection
    ...Dopamine Optogenetics Activators Inhibitors Bidirectional DREADDs Activators Inhibitors Other Molecular Tools... Viral Vector Packaging Service AAV Retrograde AAV Viral Vector Packaging Service: Retrograde...the Alla Karpova and David Schaffer laboratories. These viral vector preparations were produced with the...-EYFP Syn Activator Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics...CamKII Activator Optogenetics Deisseroth 55639 pAAV-Ef1a-fDIO hChR2(H134R)-EYFP EF1a Activator Optogenetics...(H134R)-GFP Syn Activator Optogenetics Boyden 59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics Boyden...mCherry-Fishell-3 mDIx Activator Optogenetics Fishell 65014 pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Inhibitor Optogenetics...
  2. TALEN Plasmids and Kits

    Type
    Collection
    ...contains modified pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based ...engineering. Fusions of transcription activator-like (TAL) effectors of plant pathogenic Xanthomonas spp...UTRs are included in the vector to enhance expression of the message. Both vectors utilize homodimeric FokI...the Golden Gate TALEN and TAL Effector Kit. These modified pFUS vectors can reduce the number of module...Destination vectors, pcDNA-TAL-NC2 and pCAGGS-TAL-NC2, are mammalian expression/mRNA synthesis vectors containing... These new destination vectors can be used to create TALE-transcription factors and are used at the final... of polymorphic amino acid repeats in the TAL effectors. View Addgene's TALEN Guide. These collections...
  3. CRISPR Guide

    Type
    Collection
    ...classes of base editors were cytosine base editors (purine-to-purine) and adenine base editors (pyrimidine-to-pyrimidine...base editors that can catalyze base transversions. These editors are based on cytosine base editors and...finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists ...base editors, the evolved TadA domain is fused to Cas9n or dCas9 to create the adenine base editor. The...systems use a type V-K Cas effector, Cas12k. No matter the system, the Cas effectors lack nuclease activity...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins in...
  4. Plan Your Experiment

    Type
    Collection
    ...about viral vectors and their production, see our viral vector guides . Lentiviral vectors Lentiviral ...lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector delivery. Both lentiviral...Base editor (dCas9 or Cas9 nickase fusions with different base editing proteins) Many base editors fused...fusion with transcriptional activator (such as dCas9-VP64) Many different activator systems exist, including...base editors exert their functions within a limited window from the PAM sequence, and base editor variants...CRISPR protocols from Addgene depositors ). Browse empty gRNA expression vectors . Select Your Expression ... CRISPR plasmids . Delivery Using Viral Vectors Viral vectors are a great option, as they offer high expression...
  5. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...full sequencing of the final viral vector preparation. These viral vector preparations were produced with...Intravitreal delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model...of Primary Human Hematopoietic Stem/Progenitor Cells by AAV6 Vectors: Strategies for Overcoming Donor-Variation...quality AAV preps from select plasmids in the repository. Browse the University of Florida serotype testing... Viral Vector Packaging Service AAV University of Florida Serotype...Serotype Testing Panel for the Eye and Brain Viral Vector Packaging Service: University of Florida Serotype ...
  6. Viral Production

    Type
    Collection
    ... with viral vector manufacturing facilities, such as the University of Pennsylvania Vector Core. Transfections...Pennsylvania Vector Core. In general, titering is performed by the facility that produced the viral vector lot....Empty vector particles can be identified after negative staining and appear darker than full vector particles...Electron micrograph of AAV vector preparation shows that the vast majority of the vectors consist of full particles... Viral Vector Packaging Service Viral Production Viral Production...vivo studies. Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by...to determine which facility produced your viral vector lot. At Addgene, AAV particles are titered by droplet...
  7. Chemogenetics Plasmids

    Type
    Collection
    ...cells expressing these engineered receptors. Chemogenetic receptors are popular in neuroscience, where...pathway the engineered receptor is coupled to and the specific cell type where the receptor is expressed, these...contains two main classes of chemogenetic receptors: Designer Receptors Exclusively Activated by Designer Drugs...Selective Actuator Modules (PSAMs). DREADDs are the most widely used chemogenetic receptors and are G-...Gi) and KORD are inhibitory. PSAMs are engineered α7 nicotinic acetylcholine receptor (nAChR) domains ...chemogenetic resources available at Addgene. See our inventory of chemogenetic constructs, including DREADD constructs...Service: Chemogenetics AAV Blog: Chemogenetics Viral Vectors 101 Blog: Chemogenetics vs. Optogenetics Chemogenetics...
  8. Zhang Lab CRISPR Page

    Type
    Collection
    ... in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9...Expresses dCAS9-VP64 activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with...lentiviral vector encoding dCAS9-VP64 with 2A Blast resistance marker 61426 : lentiviral vector encoding...Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9, ...61408 : Targeting vector for the mouse Rosa26 locus; Used to make Cas9 knockin mouse Vectors for cancer modeling...SpCas9 or SpCas9n, and the single guide RNA. The vector can be digested using BbsI, and a pair of annealed...indicated below) can be cloned scarlessly into the vector before the sgRNA scaffold. The oligos are designed...
  9. Viral Prep Service for Plasmids and Pooled Libraries

    Type
    Collection
    ...technologies. Penn Vector Core AAV Vectors Many AAV vectors from the Penn Vector Core have been transferred to Addgene... Viral Vector Packaging Service Addgene produces high-quality viral vector preps from select...and we’ll make the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information...about viral vector production at Addgene, ordering information, and more. Additional Viral Vector Resources...when you receive your viral vector from Addgene, with details about storage. Biosafety Guide Documentation...biosafety of viral vectors, and general biosafety guidelines. Addgene Blog: Viral Vector Posts Content from...aspects of viral vectors, including troubleshooting advice and explanations of viral vector technologies....
  10. Bacterial Expression Systems

    Type
    Collection
    ...donor) mRuby2 (acceptor) FRET Michael Davidson 18856 pGWF1 ECFP (donor) Venus (acceptor) FRET Wolf Frommer...donor) Citrine (acceptor) FRET Wolf Frommer 65617 pFLIP42 mCerulean (donor) Citrine (acceptor) FRET Wolf Frommer...CRISPR Guide Bacteria are commonly used to create, store, and replicate plasmids of all types, but beyond...strains such as E. coli BL21(DE3) are used as biofactories to express plasmids and produce proteins in ... TrxA, Mocr, NusA Cleavage sites: TEV protease, factor Xa, enterokinase, thrombin Signal peptides for ...expression in E. coli , Bacillus subtilis , and Pichia pastoris . The EcoFlex MoClo Toolkit (Addgene #1000000080...express your protein of interest fused to FPs and monitor their localization in live cells. ID Plasmid Tags...
  11. TALEN Guide

    Type
    Collection
    ...never happen. Yet with transcription activator-like (TAL) effectors, scientists in several biological disciplines... and help can be found at TALeffector Resources Center (www.taleffectors.com) . Whether you work in a ...between two distinct ZF target sites. (B) A TAL effector nuclease (TALEN). Similar in principle to the ...published the nucleotide recognition code of the TAL effectors, which were isolated from the plant bacterial ...that determines which single nucleotide the TAL effector will recognize: ( Figure 1B ) HD targets cytosine... in your average genome are every 500 bp. TAL effectors have some restrictions (for example, the target...determining the importance of context for each TAL effector within an array, but early studies suggest the...
  12. Luciferase Plasmid Collection

    Type
    Collection
    ...cells Peter Cockerill 212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription...reporting on GPCR activity. AIMTOR : BRET biosensor for live imaging of mTOR signaling. Do you have suggestions...made luciferase a popular tool for scientists. Regulatory elements such as promoters, enhancers and untranslated...backbone plasmids into which you can clone your regulatory element or gene of interest into to create a ...Scott Lowe 21375 pHIV-Luciferase Firefly Lentiviral vector for insertion of your gene of interest upstream...and renilla_polyA Firefly, Renilla Dual reporter vector. Insertion of 5' promoter/enhancer regions upstream...212935 pGL4.84(hRlucCP/Puro) RapidResponse™ Renilla Vector for investigating regions controlling transcription...
  13. p53 Pathway

    Type
    Collection
    ... Tumor necrosis factor receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell ... PAI Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 PERP...p14ARF Cyclin-dependent kinase inhibitor 2A p21 Cyclin-dependent kinase inhibitor 1A p48 Damage-specific DNA...plasmids for the p53 pathway. p53 is a transcription factor and tumor suppressor activated by cellular stress...Pathway You May Also Like: Cancer Pathway ORF Kit mTOR pathway Ras pathway Background p53 Pathway Plasmids...List References Background p53 is a transcription factor and tumor suppressor activated by cellular stresses..., which disrupt its interaction with negative regulators, increase its stability and DNA binding activity...
  14. Validated gRNA Sequences

    Type
    Collection
    ...EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria GAAGTTCGAGGGCGACACCC... EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria GATGCCGTTCTTCTGCTTGT... EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGCCACAAGTTCAGCGTGTC...EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria GGGCACGGGCAGCTTGCCGG... EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria GGGCGAGGAGCTGTTCACCG... EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGTGGTGCAGATGAACTTCA... GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA...
  15. Neurodegeneration Research Collection

    Type
    Collection
    ...upper and lower motor neurons in the brain and spinal cord. Over time, a loss of motor neurons leads to...AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell ...tet-inducible expression of transcription factors for sensory, motor, and cortical neuron differentiation....CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies Fluorescent Proteins Other Resources...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases...portion of cases can be attributed to known genetic factors such as defects in LRRK2, SNCA, PARK7, or PINK1... gene variation and lifestyle or environmental factors. For example, variations of Apolipoprotein E (APOE...
  16. Plant Plasmids and Resources

    Type
    Collection
    ...assembling plant transformation vectors - Daniel Voytas. Transcription Factors The following collections can...plants: Maize Transcription Factor ORFeome - John Gray. Rice Transcription Factor ORFeome - John Gray. Plant...microRNA and siRNA vectors in Arabidopsis - James Carrington. JoinTRV , an improved vector system based on...Blog: Plant Biology CRISPR Cloning Transcription Factors RNAi Empty Backbones Fluorescent Proteins Other...Other Resources Background Addgene’s repository contains many plasmid tools that were specifically designed...plant species (e.g. maize and Arabidopsis) and vectors for easy assembly of one or more gRNA expression...for Plants includes CRISPR/Cas nucleases, base editors, gRNA backbones, and promoters for expression in...
  17. Rett Syndrome

    Type
    Collection
    ...Nuclear receptor Co-Repressor 1/Silencing Mediator of Retinoic acid and Thyroid hormone receptor (NCoR/...Cell Line Repositories (Link opens in a new window) Coriell Institute - cell line repository, including...in a new window) MMRRC Repository - NIH-supported mouse and cell line repository (Link opens in a new window...largest biorepositories (Link opens in a new window) ATCC - the world's largest cell line repository Tissue... working with the RSRT along with individual laboratories to assemble a Rett Syndrome plasmid resource...The MECP2 protein is a global transcriptional regulator of thousands of genes and studies have suggested...location and type of MECP2 mutation can be a strong predictor of symptom severity. Broadly, early gene disruptions...
  18. AAV Packaged on Request

    Type
    Collection
    ...Resources Viral Vector Production Learn about how we produce high-quality viral vector preps at Addgene...Request service with all-in-one pricing for viral vector preps, which includes MTA facilitation, DNA amplification... Viral Vector Packaging Service Packaged on Request AAV Packaged...Additional Resources Adeno-associated virus (AAV) vectors are safe and useful gene delivery tools that effectively...protection levels. We offer 1,001 in-stock viral vector preps, delivering high quality and ready availability...availability at affordable prices. While our repository serves the needs of many researchers, scientists sometimes... the steps to produce, purify, and titer viral vectors. Overview Our new Packaged on Request service is...
  19. Lentiviral Prep Service

    Type
    Collection
    ...more details about our viral vector packaging service, visit our Viral Vector Packaging Service page . Pooled...dCas9) can be fused to a transactivator and used as a transcriptional activator . ID Name Insert Antibiotic...Ready-to-use lentivirus available from Addgene's viral vector packaging service. Browse constructs currently ... Viral Vector Packaging Service Lentivirus Browse In-Stock Lentivirus... made from plasmids that are currently in our repository. You can obtain the plasmid from us or receive...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified... that harbors targeting sequences. Browse our repository for a list of gRNA plasmids targeting specific...
  20. CRISPR Plasmids - Tagging

    Type
    Collection
    ...targeting vector assembly, and the remaining 5 plasmids include Cre and FLP expression vectors, a general...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ...Cas plasmid-system consists of two components: A vector containing Cas9 and a validated gRNA, based on ...tagging system were tested by tagging transcription factors with FLAG in human cell lines. To repeat the tagging...the isolation of native protein complexes. This vector serves as a backbone to clone the left and right...Alternatively, cDNAs can be cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus...gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_...
Showing: 21 - 40 of 154 results