We narrowed to 59 results for: ara-2
-
TypeCollection... mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an X-linked disorder...X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens in a new window... Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity... Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome. Neurology...males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67... incidence of approximately 1:10,000. It is characterized by apparently normal development through the... database of clinical features and genetic characteristics of Rett syndrome (Link opens in a new window...
-
Validated gRNA Sequences
TypeCollection...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017 Zaratiegui ade6...TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes... -
Lentiviral Prep Service
TypeCollection...Barcode Library Version 2 Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding...barcoding library. Version 2 of the Celltag library contains 4934 barcodes to combinatorially index cells for...plasmid from us or receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed... in a new window) . Please note this does not guarantee viral service, but lets us know what viruses would... -
Viral Production
TypeCollection...suggests that titers obtained using ddPCR are generally 2–3 fold higher than those achieved using the standard...catalog item (see maps section for images). Figure 2: AAV Pro cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre... a new vial of early passage cells. Approximately 2 weeks post-thaw, cell culture supernatant is tested...specific virus in order to generate high quality preparations. After production, all virus preps are titered...plasmid encoding adenoviral helper sequences. AAV preparations are purified by iodixanol gradient ultracentrifugation...purity and titers adequate for in vivo studies. Preparations are then aliquoted and stored at -80 °C. Titer...on viral genomes isolated from the final AAV preparation. Sequencing results are analyzed to confirm the... -
Optogenetics AAV Preps
TypeCollection...Constitutive 1, 2, 5, 9 Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ChR2/H134R EYFP Constitutive 1, 2, 5, 9....WPRE.SV40 CAG ChR2/H134R mCherry Constitutive 1, 2, 5, 9 Deisseroth 127090 pAAV-CAG-DIO-ChR2(H134R)-eYFP...pAAV-EF1α1.1-ChrimsonR-GFP EF1a ChrimsonR GFP Constitutive 2 Boyden 124650 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1...pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR 3.0 EYFP Constitutive 2, 5 Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF NpHR...table and filters below to find ready-to-use AAV preparations of optogenetics plasmids available in Addgene's... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know... -
Neurodegeneration Research Collection
TypeCollection...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop...study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study the C terminal domain of TDP-43 to better understand... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...Neurodegenerative diseases are a group of disorders characterized by the progressive degeneration and ultimate...biology of these diseases, rather than focusing on separate diseases, will help speed progress towards curing... -
Zhang Lab CRISPR Page
TypeCollection...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9... Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub 2014... -
mTOR Pathway
TypeCollection...known as RPS6KB1; Ribosomal protein S6 kinase B1 TSC1/2 TSC1 TSC2 Tuberous sclerosis VHL Von Hippel-Lindau...Rictor RPTOR independent companion of MTOR, complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return...disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID...mTORC2. Background mTORC1 & mTORC2 The better-characterized mTORC1 responds to various signals, including... -
CRISPR History and Development for Genome Engineering
TypeCollection...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...contiguous stretches of DNA known as CRISPR arrays. Separate Cas proteins then express and process the CRISPR...have homology to foreign DNA. Protospacers are separated by short palindromic repeat sequences. (1) The... -
CRISPR Plasmids - Double-Strand Break (Cut)
TypeCollection... with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA PAM site. When ...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...Insert Promoter Selectable Marker PI Publication Parasites ID Plasmid Gene/Insert Promoter Selectable Marker... -
AAV Molecular Tools
TypeCollection...constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin...receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven...voltage-gated Na+ channel mNaChBac and (physically separate) tdTomato 8 Scanziani 34910 paavCAG-pre-mGRASP-mCerulean... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know... -
Mammalian RNAi Tools
TypeCollection...degrades the mRNA. RISC includes argonaute protein 2 (Ago2), which facilitates cleavage of the target. ... International Journal of Biomedical Science, 13 (2), 48–57. PubMed (Link opens in a new window) . Moore...Ebrahimi, M., Rashno, M. M., Abadi, S. J., & Gharagouzlo, E. (2017). Molecular mechanisms and biological... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa...modification. Maeder ML et al. Mol Cell. . 2008. Jul 25. 31(2):294-301. PubMed PMID 18657511 . Oligomerized pool...activity of three-fold or greater in a well-characterized bacterial two-hybrid reporter system but have... -
CRISPR Guide
TypeCollection...gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately. They can knockout, ...left free to interact with the target DNA. Figure 2: Overview of the NHEJ repair mechanism Cas9 will only...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ... -
Fluorescent Protein Guide: FRET
TypeCollection...referred to as intermolecular or bimolecular FRET) or (2) conformational changes within a protein where the...standard consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide linker standard consisting...protein-protein interactions where each protein is separately fused to a donor or acceptor molecule (also referred... Standards The following plasmids have well-characterized FRET efficiency values and were developed to... FRET standards to calibrate the numerous and disparate methods used to measure FRET. Plasmid FRET Pair...Brightness standard used as positive control to characterize mTurquoise2 pmTurquoise2-T2A-Venus(L68V) Brightness... -
Biosensor AAV Preps
TypeCollection..., Huebener , Rose 83899 pAAV-mDlx-GCaMP6f-Fishell-2 Dlx GCaMP6f none Constitutive 1, 9, rg* Fishell 100833...pAAV.CAG.GCaMP6f.WPRE.SV40 CAG GCaMP6f none Constitutive 1, 2, 9 Kim , GENIE 100837 pAAV.Syn.GCaMP6f.WPRE.SV40 Syn...pAAV-CAG-NIR-GECO2G CAG NIR-GECO2G none Constitutive 1, 2, 9 Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP....v857.PDGFR CAG iGluSnFr3 v857 none Cre dependent 2 Podgorski Glutamate Sensor: SF-iGluSnFr 106174 pAAV.hSynapsin.SF-iGluSnFR.A184S...pAAV-hSyn-GRAB_g5-HT3.0 Syn GRAB_g5-HT3.0 none Constitutive 1, 2 Li No available items found to match all requested... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know... -
Antibody Guide
TypeCollection... unknown Monomer with a valency of 2 IgE Protects against parasites and is responsible for driving allergic...such as anaphylactic shock Monomer with a valency of 2 IgG The most abundant isotype in blood, also found...secondary immune response Monomer with a valency of 2 IgG1; IgG2; IgG3; IgG4 IgM Produced during the primary... ranging from antibody fragments (shown in Figure 2) to completely unrelated molecules. Examples include...used for assembling protein nanostructures. Figure 2: An antibody (IgG, far left) compared to alternative... can be used in the lab to quantify, identify, separate, and locate proteins of interest. The protein ...use antibodies to identify denatured proteins separated by size on an SDS-PAGE gel. Though relative quantification... -
CRISPR Plasmids - Repress Gene Expression
TypeCollection...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...not also express a gRNA, you will need to use a separate gRNA expression plasmid to target the dCas9-repressor... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...not also express a gRNA, you will need to use a separate gRNA expression plasmid to target the dCas9-activator... -
Plan Your Experiment
TypeCollection...components (Figure 2), and the optimal system will likely depend on your cell type. Figure 2: Different delivery...either (1) a lack of gRNA and/or Cas9 expression or (2) a lack of efficient target cleavage in cells that...CRISPR-Based genome editing. Trends in Biotechnology , 36 (2), 173–185. https://doi.org/10.1016/j.tibtech.2017.11.006... Villalta, J. E., Chen, Y., Whitehead, E. H., Guimaraes, C., Panning, B., Ploegh, H. L., Bassik, M. C....