Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 45 results for: kit

Showing: 21 - 40 of 45 results

  2. Bacterial Expression Systems

    Type
    Collection
    ... interaction. The cpFRET - FRET-based Biosensors Kit (Addgene #1000000021) is a vector library for the...plants. The Zinc Finger Consortium Modular Assembly Kits (Addgene #1000000005, 1000000010) contain plasmids...Visit our TALEN Collection page to find plasmids and kits for efficient assembly of TALEN constructs. The ...subtilis , and Pichia pastoris . The EcoFlex MoClo Toolkit (Addgene #1000000080) features a library of promoters...biosensors for ratiometric measurements. The MoBiFc Toolkit (Addgene #1000000222) is a collection of Golden...

  3. CRISPR Plasmids and Resources

    Type
    Collection
    ...select CRISPR lentiviral plasmids. CRISPR Plasmid Kits : Find groups of plasmids that are used together...

  4. CRISPR References and Information

    Type
    Collection
    ...inhibition, and barcoding. CRISPR Kits Addgene's collection of CRISPR plasmid kits. CRISPR Software Sanger Indel...by the Hyongbum Kim Lab . GenET (Genome Editing Toolkit) (Link opens in a new window) A library of various...

  5. Antibody Plasmid Collection

    Type
    Collection
    ...into a single mammalian expression vector A tool kit for rapid cloning and expression of recombinant antibodies...

  7. Luciferase Plasmid Collection

    Type
    Collection
    ...control of neuronal signaling. TRUPATH Kit , ONE-GO Biosensors Kit , and G-CASE : BRET-based sensors for...

  8. Validated gRNA Sequences

    Type
    Collection
    ...26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus...CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S....

  9. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Fluorescent Protein Fusion Construct Kit Neveu Lab MXS Chaining Kit Luciferase Plasmid Collection Promega...Expression Return to top Additional Resources Plasmid Kits and Collections Empty Backbone Collection Michael...

  10. p53 Pathway

    Type
    Collection
    ...p53 Pathway You May Also Like: Cancer Pathway ORF Kit mTOR pathway Ras pathway Background p53 Pathway Plasmids...

  12. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... the cpFRET kit from the Pertz laboratory to construct custom biosensors. The ScEnSor Kit from the Olsson...neuropeptides VIP, NPY, CCK, NTS, UCN, SST, and CRF A tool kit of highly selective and sensitive genetically encoded...intracellular environment of S. cerevisiae . The MOSAIC Kit from the Cohen laboratory includes 35 plasmids expressing... Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0 and iATPSnFR1.1.... PLoS One. 2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based...imaging. Sci Rep. 2017 Aug 4;7(1):7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor of cyclic...PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP (cyclic GMP) FlincG3 (GFP-based cGMP sensor...

  13. Fluorescent Proteins: FRET

    Type
    Collection
    ...biosensors with the cpFRET kit from the Pertz Lab or the 2in1 Plasmid Toolkit from the Grefen Lab. FRET...

  14. CRISPR Plasmids - Tagging

    Type
    Collection
    ...repair template for an individual tagging event. The kit contains 26 plasmids; 21 of the plasmids are for ...Jorgensen Lab SapTrap CRISPR/Cas Toolkit SapTrap is a modular toolkit from Erik Jorgensen's lab for building...targeting vector. Jorgensen Lab SapTrap CRISPR/Cas Toolkit Kanemaki Lab Auxin-Inducible Degron Tagging Masato...

  15. COVID-19 Resources

    Type
    Collection
    ... Addgene's Protocol for RNA Extraction Without A Kit Bloom lab - Protocol and Reagents for Pseudotyping...

  17. Immunology Research Plasmids and Resources

    Type
    Collection
    ... Additional Resources Plasmid Kits and Collections Human Kinase ORF Kit : 558 distinct human kinases and...growth factor-like protein 2 - KITLG KIT ligand DKFZp686F2250, KL-1, Kitl, MGF, SCF, SF, SHEP7 KL klotho...Root . Multiple Lentiviral Expression (MuLE) System Kit : A modular and flexible system that can be used ...infection from the lab of Ian Frew . MXS Chaining Kit : From the lab of Pierre Neveu , the MXS-chaining...applications in mammalian systems. The MXS-chaining kit includes chaining vectors with multiple cloning sites... inducible gene expression. Myristoylated Kinase Kit : Consists of 190 human kinases and kinase-related... Hahn , Matthew Meyerson , and David Root , this kit consists of 182 wild-type and 19 well-characterized...

  18. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Description PI Multiplex CRISPR/Cas9 Assembly System Kit Mammalian A system for constructing all-in-one expression... Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit for multiplex genome editing in plants Plant Plasmids...

  19. Antibody Guide

    Type
    Collection
    ... the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray film in a ...

  20. CRISPR Guide

    Type
    Collection
    ...protein-interacting RNA aptamers, such as in the CRISPRainbow kit . Using multiple copies of the aptamer improves stability...
Showing: 21 - 40 of 45 results