Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 80 results for: met

Showing: 21 - 40 of 80 results

  1. Antibody Production

    Type
    Collection
    ...are initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is...Overview of Addgene's antibody production methods and quality control processes for purified recombinant... scientists. They are generated using standard methods individually optimized for each specific antibody...Details about our production protocols, titering methods, and quality control are described below. Information...PCR product is purified, sequenced via the Sanger method, and aligned with the parental plasmid sequence...

  2. Fluorescent Proteins: FRET

    Type
    Collection
    ...pNCS-CyOFP , mCardinal-N1 mAmetrine* tdTomato 406 0.58 581 138,000 0.69 6.5 7.1 mAmetrine-N1 , tdTomato-N1 mTurquoise2...distance between the fluorophores at the single-nanometer scale, scientists can use FRET to report on protein...Collection to find fluorescent biosensors targeting metal ions, small molecules, and more. Popular FRET Pairs...Protocol for deriving proximity, affinity, and stoichiometry of protein interactions using image-based quantitative...its potential while avoiding pitfalls . Nature Methods , 16 (9), 815–829. doi: https://doi.org/10.1038...

  3. Antibody Plasmid Collection

    Type
    Collection
    ... and Evolving Functional Proteins. METHODS: A Companion to Methods in Enzymology 8, 94–103 (1995). Carlos...Monoclonals with Engineered Immune Effector Functions. Methods Mol Biol. 2018;1827:313-334. Daniel Christ pComb3...diabody and Fab fragment libraries from chickens Methods for the generation of chicken monoclonal antibody...antibody fragments by phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector ...

  4. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    .... Below are some common delivery methods. Delivery method Advantages Representative Empty ...Inducible gene expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC...our dedicated Cre-lox Plasmids page pBF3060 - Metabolic engineering in S. cerevisiae TALENs Gene targeting... Selectable Markers Regardless of your delivery method, it's unlikely that all of your cells will...

  5. mTOR Pathway

    Type
    Collection
    ...J, Kim SG, Blenis J. Cell Metab. 2014 Mar 4;19(3):373-9. doi: 10.1016/j.cmet.2014.01.001. PubMed PMID:...mTOR pathway. enhanced signaling of mTOR, a key metabolic regulator, correlates with poor prognosis in many...ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation...

  6. Plant Plasmids and Resources

    Type
    Collection
    ...promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI Return to top Fluorescent...synthetic operons for chloroplast transformation and metabolic engineering in plants (including tobacco and potato... opens in a new window) - Transcriptomic and metabolomic resources for 14 key medicinal plants for the...

  7. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...histone demethylation by LSD1, cytosine methylation by DNMT3A or MQ1, and cytosine demethylation by Tet1...on factors such as selectable marker or cloning method. To isolate mammalian vectors, simply type "Mammalian...

  8. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mAmetrine 406 526 26 6 1.8 min Monomer (A206K) pBad-mAmetrine - Bacterial Expression mAmetrine-N1 ...and cloning of fusion proteins, along with key parameters to help you plan your experiment. Tables are ...mAmetrine-N1 - Mammalian Expression mAmetrine-C1 - Mammalian Expression LSSmOrange 437 572 23 5.7 2.3 h Monomer pLSSmOrange-C1...

  9. CRISPR Plasmids - Tagging

    Type
    Collection
    ...tagging methods allow for improved efficiency and throughput over traditional tagging methods. Several...developed a simple and scalable CRISPR/Cas-based method to tag endogenous proteins by using donor constructs...Seydoux's lab has developed a systematic and scalable method to create marker-free mutations, insertions, and...

  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR 71667 Mammalian U6 yes, methylation S. pyogenes...pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation S. pyogenes Puro Zoldos pBLO1811_Cas9_noNLS_human...expression cassette using the Golden Gate cloning method. A separate accessory pack is available for dCas9... in this Golden Gate and Gateway based assembly method: plasmids for assembly of single gRNA vectors with...

  11. Deisseroth INTRSECT Collection

    Type
    Collection
    ...payloads in target populations defined by multiple parameters....payloads in target populations defined by multiple parameters. Figure 1: Examples of intersectional cell population...combination of genetic and/or anatomical-defined parameters, by placing two orthogonal recombinase (Cre and...vectors using multiple-feature Boolean logic. Nat Methods 11(7):763-72. PubMed (Link opens in a new window...

  12. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...bases without creating a double-strand break. This method displays higher efficiency than HDR-mediated editing...the overall effect is an A->G change. Since this method targets RNA rather than DNA, it does not create...targeting : Cas13 enzymes target RNA rather than DNA, sometimes requiring a protospacer flanking sequence (PFS...biotin-streptavidin pulldown (CAPTURE.) Tag : Multiple methods make it easier to tag endogenous loci with epitope...

  13. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Lindquist 15589 MET FLAG46QDProCFPp303 HTT FLAG, CFP MET1 Huntington's Susan Lindquist 15590 MET FLAG72QDProCFPp303...FLAG, CFP MET1 Huntington's Susan Lindquist 15591 MET FLAG103QDProCFPp303 HTT FLAG, CFP MET1 Huntington's...FTD Ahmet Yildiz 159719 pOmnibac_ZZ_linker_ybbR_Tau MTBD MAPT ZZ, ybbR polH Parkinson's, FTD Ahmet Yildiz...Carlos Igual 89925 Profiline PFN1 T7 ALS Guillaume Romet-Lemonne 92200 pINDUCER20-delta-Syn SNCA Myc TRE2...

  14. Mammalian RNAi Tools

    Type
    Collection
    ...viral vectors. Lentiviral vectors are a preferred method for long-term gene silencing. Once the viral vector..., delivery, and assessment of gene knockdown . Methods in Molecular Biology, 629 , 141–158. PubMed (Link...conditional systems for RNA interference . Nature Methods, 3 (9), 682–688. PubMed (Link opens in a new window...

  15. Microbiology Resources

    Type
    Collection
    ...Archaea Species Haloferax sp. Methanococcus maripaludis Methanothermobacter thermautotrophicus Sulfolobus...is not always straightforward. Read our CRISPR Methods for Bacterial Genome Engineering blog post to see...

  16. AAV Packaged on Request

    Type
    Collection
    ...serves the needs of many researchers, scientists sometimes require preps beyond our current in-stock capabilities... contributing your AAV vector experience, from methods to troubleshooting insights, you make research ...goes unshared, bridging the gap between published methods and real-world troubleshooting. Eligible Plasmids...

  17. Validated gRNA Sequences

    Type
    Collection
    ...25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna Mettl14 M. musculus...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...

  18. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...mutant adeno-associated viral vector. Hum Gene Ther Methods . Feb;25(1):72-82. PMID: 24191859 Ye, et al. 2015...Engineered AAV Capsids Improve Transduction and Volumetric Spread in the CNS. Mol Ther Nucleic Acids . Sep...by novel capsid-modified AAV6 vectors. Mol Ther Methods Clin Dev . Apr 13;3:16026. PMID: 27308302 AAV44.9...

  19. Zinc Finger Consortium Reagents

    Type
    Collection
    ...Reagents - Engineer zinc finger arrays via OPEN method Modular Assembly Engineering Reagents - Engineer...Engineer zinc finger arrays via Modular Assembly method Nuclease Expression Vectors - Cloning vectors for expressing...
Showing: 21 - 40 of 80 results