Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 125 results for: ANT

Showing: 41 - 60 of 125 results

  1. Synthetic Biology - Overview

    Type
    Collection
    ... Standard European Vector Architecture Open Plant - Plant SynBio resource Synthetic Biology - Open access...Mukhopadhyay Richard Murray Erin O'Shea Martin Parniske Antonio Richart Herbert Sauro Claudia Schmidt-Dannert Pamela...pairs. Browse Plasmids by Model Organism Bacterial Plant Yeast Mammalian Worm Fungal Algal Featured SynBio...FREQ-Seq Kit FX Cloning Kit GreenGate Cloning System (Plant) MoClo Modular Cloning Modular PUF Assembly Kit ...Kit Optogenetics Pertz Lab cpFRET Kit Rinehart Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway...

  2. AAV for Neuronal Tracing

    Type
    Collection
    ...pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies virus AAV1 Ian Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA...AAV together can be used to complement deletion-mutant rabies virus AAV1 Ian Wickersham 100799 pAAV-TREtight-mTagBFP2...the cell population of interest with a deletion-mutant tracing virus that lacks the ability to infect ... To enable monosynaptic spread of this deletion-mutant rabies, the essential G protein is provided to ...2007a. Retrograde neuronal tracing with a deletion-mutant rabies virus. Nat Methods. 4(1):47-9. PMID: 17179932... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

  3. Bacterial Expression Systems

    Type
    Collection
    ... to enhance protein solubility and to direct recombinant proteins to the periplasmic space between the...bimolecular fluorescence complementation experiments in plants. The Zinc Finger Consortium Modular Assembly Kits...to top Controlled Expression It isn’t always advantageous to constitutively express your gene of interest...leads to slow bacterial growth, or maybe you only want to study the effects of protein expression in the...the stationary phase. In these cases, you may want to control protein levels or to turn on expression ...presence of that small molecule and sometimes even quantify it. Bacterial one-hybrid (B1H) systems also use... or introducing specific mutations can reveal important insights into gene function. These genetic changes...

  4. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...results. Attenuated iCre(R297T), a point mutant iCre variant, reduces the number of recombination events...Site Canonical Sequence Structure (Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13...turning on another. The FLEx switch system takes advantage of the orientation specificity of Cre and the ...different types of target sites available, both mutant and wild type. The ability to manipulate the number... to genomic instability and cell death. It is important to incorporate appropriate controls such as Cre-only...

  5. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...CRISPR systems, the most abundant type found in bacteria and archaea. While abundant in nature, Class 1 systems...CRISPR Plasmids: Cascade-Cas3 Mammalian Bacteria Plant Resources Cas3 is a unique member of the CRISPR ...double-strand break, either due to a boundary defined by anti-CRISPR proteins or running into other proteins bound...Gene/Insert Promoter PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter PI Publication Return...

  6. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...Edit CRISPR Plasmids: Base Edit Mammalian Bacteria Plant Yeast Zebrafish Resources Two classes of base editors... base editors are available with multiple Cas9 variants including high fidelity Cas9’s. Further advancements...fusions, modifying the linker region between Cas variant and deaminase to adjust the editing window, or ...systems create a wide spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window... Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable Marker...

  7. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Yeast Expression mGreenLantern 503 514 73 5.6 14 min Monomer (A206K) pcDNA3.1-mGreenLantern - Mammalian Expression... Expression pAAV-CAG-mGreenLantern - Mammalian AAV Expression pBAD-mGreenLantern - Yeast Expression Clover... is the product of exctinction coefficient and quantum yield divided by 1,000. Note that the effective...10His-mStayGold (E138D) - Bacterial Expression pJRA110 - Plant Expression mStayGold 499 510 136 4.8 Monomer pRSETB... to top Fluorescent Timers Fluorescent protein variants that change their fluorescence from the blue to...

  8. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...information. Plasmids Expressing Spike and Spike Variants Full-length wildtype SARS-CoV-2 spike protein ...D614G change which is present in many circulating variants. The table below lists expression plasmids that...protein (MERS, CoV-1, CoV-2), modification, or variant. ID Plasmid Description Mutations Industry PI Due...Addgene Blog Posts Viral Vectors 101: Pseudotyping Antibody Neutralization Response Against Pseudoviruses ...Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants Addgene COVID-19 Resources and Collections COVID-19 and...

  9. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...

  10. AAV Molecular Tools

    Type
    Collection
    ...-mPCSK9 hAAT-driven, constitutive Expression of mutant (D377Y) murine PCSK9 for studying hypercholesterolemia...mScarlet-KASH for silencing neurons 8 Ivo Spiegel Anterograde Transsynaptic Tracers These AAV encode tools ...that can be used to map neural circuits in the anterograde direction across synapses. Also see Monosynaptic...232351 pAAV-ATLASsnCre Syn-driven, constitutive Anterograde transsynaptic tracer protein to express in presynaptic... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

  11. Plasmids for Stem Cell Research

    Type
    Collection
    ... to embryonic stem cell use and has the major advantage that iPSCs can potentially be derived from patient-specific...mutation and minimize tumorigenicity, an inherent disadvantage of iPS cell technology. Browse Addgene's collection...create cell lines with endogenously-tagged gene variants or browse Addgene’s entire collection of Stem ...and Xeno-Free Culture Conditions: A Clinically Compliant Approach. Stem Cells Transl Med. 2015 Mar 5. pii...Mouse Direct reprogramming of fibroblasts into antigen-presenting dendritic cells. Sci Immunol. 2018 Dec...Lentiviral Mouse Direct Induction of the Three Pre-implantation Blastocyst Cell Types from Fibroblasts. Cell...

  12. Tetracycline Inducible Expression

    Type
    Collection
    ...hormones or metal ions, scientists have adapted an antibiotic resistance operon from E. coli : the tetracycline...elements like the H1 RNA promoter. And, most importantly, the TetR protein has been modified to provide...identify the amino acid residues of TetR that were important for tetracycline-dependent repression. Mutating...). rtTA3 and Tet-On 3G : further improved rtTA variants with lower background activity and greater sensitivity...#85972 for hygromycin selection. TetR H1-2O2 Cindy Miranti 104321 tet-pLKO-sgRNA-puro Lentiviral Tet-On plasmid...Lentiviral Tet-On inducible RNAi with miR-E (miR-30 variant)-based backbone rtTA-Advanced TRE3G Johannes Zuber...

  13. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...collection differ based on some important criteria, and it is important to know which library best... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...with the pooled library to create a population of mutant cells that are then screened for a phenotype of...representation. CRISPR screening experiments require large quantities of cells and therefore, may not be suitable for...best suits your particular experiment. Some important variables include: Type of genetic modification - ...

  14. Validated gRNA Sequences

    Type
    Collection
    ...gRNA activity. Know your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this...compatible with a single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with...GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C. elegans GCTACCATAGGCACCACGAG...CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S....

  15. Optogenetics AAV Preps

    Type
    Collection
    ...other mutants Chronos, Chrimson, ChRmine, ChroME, ChETA, C1V1 (t/t) Inhibitory Arch and variants eNpHR...eNpHR and variants InSynC (non-opsin) Jaws WiChR stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter...AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

  16. Depositor Collections

    Type
    Collection
    ...Collections Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection Disease...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression... Simpson Reagents for improved expression of recombinant phosphoproteins - Rinehart FreeGenes Project ...

  17. CRISPR Plasmids - gRNAs

    Type
    Collection
    ... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources... increases off-target effect. Which species or variant of Cas9 ( S. pyogenes , S. aureus etc.) was this...compatible with a single species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be...information and assistance with the deposit process. Want more information on the wide variety of Cas enzymes...

  18. CRISPR Plasmids and Resources

    Type
    Collection
    ...designed for use in parasites. Plant CRISPR plasmids designed for use in plants. Yeast CRISPR plasmids designed... for a variety of organisms, including mammals, plants, bacteria, yeast, Drosophila, zebrafish, C. elegans...tool for genome engineering. CRISPR Topic Page : Want the latest news on CRISPR? Experts cover CRISPR ...

  19. Adenovirus Plasmids

    Type
    Collection
    ...mild to severe respiratory disease in humans. Advantages of adenoviruses in research include their large...adenoviruses do not integrate into the host genome. Disadvantages of adenoviruses include transient transgene ...transgene expression, as well as the substantial immune response induced by the viral capsid. Adenoviruses can...Plasmids Common shuttle and adenoviral plasmids. Want an adenoviral plasmid with your gene of interest...

  20. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...protein, and is suitable for both cell-permeant and non-cell-permeant proteins. CLIP-tag CLIP-tag is identical...proteins with disulfide bridges such as antibodies. MCP-tag is a mutant of ACP-tag, and is labeled by SFP Synthase...
Showing: 41 - 60 of 125 results