We narrowed to 126 results for: ANT;
-
TypeCollection...through our Packaged on Request service, Addgene guarantees a titer of at least 4 x 10 12 GC/mL for the AAV1... you know that we don’t expect to produce our guaranteed titer, and will give you the option to proceed...proceed with your order, or not, without a guaranteed titer. Any titer expectations communicated by email ...email will supersede the general guarantees above. We will have our expert viral vector production team carefully...our viral production does not yield the titer guaranteed here or by email, Addgene will contact you to...carried out with our materials, Addgene cannot guarantee the function of any viral vector. Addgene performs...
-
Synthetic Biology - Overview
TypeCollection... Standard European Vector Architecture Open Plant - Plant SynBio resource Synthetic Biology - Open access...Mukhopadhyay Richard Murray Erin O'Shea Martin Parniske Antonio Richart Herbert Sauro Claudia Schmidt-Dannert Pamela...pairs. Browse Plasmids by Model Organism Bacterial Plant Yeast Mammalian Worm Fungal Algal Featured SynBio...FREQ-Seq Kit FX Cloning Kit GreenGate Cloning System (Plant) MoClo Modular Cloning Modular PUF Assembly Kit ...Kit Optogenetics Pertz Lab cpFRET Kit Rinehart Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway... -
AAV for Neuronal Tracing
TypeCollection...pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies virus AAV1 Ian Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA...AAV together can be used to complement deletion-mutant rabies virus AAV1 Ian Wickersham 100799 pAAV-TREtight-mTagBFP2...the cell population of interest with a deletion-mutant tracing virus that lacks the ability to infect ... To enable monosynaptic spread of this deletion-mutant rabies, the essential G protein is provided to ...2007a. Retrograde neuronal tracing with a deletion-mutant rabies virus. Nat Methods. 4(1):47-9. PMID: 17179932... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know... -
Bacterial Expression Systems
TypeCollection... to enhance protein solubility and to direct recombinant proteins to the periplasmic space between the...bimolecular fluorescence complementation experiments in plants. The Zinc Finger Consortium Modular Assembly Kits...to top Controlled Expression It isn’t always advantageous to constitutively express your gene of interest...leads to slow bacterial growth, or maybe you only want to study the effects of protein expression in the...the stationary phase. In these cases, you may want to control protein levels or to turn on expression ...presence of that small molecule and sometimes even quantify it. Bacterial one-hybrid (B1H) systems also use... or introducing specific mutations can reveal important insights into gene function. These genetic changes... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...results. Attenuated iCre(R297T), a point mutant iCre variant, reduces the number of recombination events...Site Canonical Sequence Structure (Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13...turning on another. The FLEx switch system takes advantage of the orientation specificity of Cre and the ...different types of target sites available, both mutant and wild type. The ability to manipulate the number... to genomic instability and cell death. It is important to incorporate appropriate controls such as Cre-only... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Yeast Expression mGreenLantern 503 514 73 5.6 14 min Monomer (A206K) pcDNA3.1-mGreenLantern - Mammalian Expression... Expression pAAV-CAG-mGreenLantern - Mammalian AAV Expression pBAD-mGreenLantern - Yeast Expression Clover... is the product of exctinction coefficient and quantum yield divided by 1,000. Note that the effective...10His-mStayGold (E138D) - Bacterial Expression pJRA110 - Plant Expression mStayGold 499 510 136 4.8 Monomer pRSETB... to top Fluorescent Timers Fluorescent protein variants that change their fluorescence from the blue to... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...information. Plasmids Expressing Spike and Spike Variants Full-length wildtype SARS-CoV-2 spike protein ...D614G change which is present in many circulating variants. The table below lists expression plasmids that...protein (MERS, CoV-1, CoV-2), modification, or variant. ID Plasmid Description Mutations Industry PI Due...Addgene Blog Posts Viral Vectors 101: Pseudotyping Antibody Neutralization Response Against Pseudoviruses ...Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants Addgene COVID-19 Resources and Collections COVID-19 and... -
Retrovirus Plasmids
TypeCollection...Large T antigen for creation of immortalized cells (see Weinberg Lab page for resistance variants) Weinberg...results in long-term transgene expression. Some disadvantages of γ-retroviruses are that they can only transduce... Plasmids Common γ-retroviral transfer plasmids. Want a retroviral plasmid with your gene of interest?...expression; also expresses GFP. Also see pMIG-w , a variant that has WRE, a post-transcriptional regulatory... -
CRISPR Plasmids - Drosophila
TypeCollection...Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands... -
AAV Molecular Tools
TypeCollection...-mPCSK9 hAAT-driven, constitutive Expression of mutant (D377Y) murine PCSK9 for studying hypercholesterolemia...mScarlet-KASH for silencing neurons 8 Ivo Spiegel Anterograde Transsynaptic Tracers These AAV encode tools ...that can be used to map neural circuits in the anterograde direction across synapses. Also see Monosynaptic...232351 pAAV-ATLASsnCre Syn-driven, constitutive Anterograde transsynaptic tracer protein to express in presynaptic... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know... -
Plasmids for Stem Cell Research
TypeCollection... to embryonic stem cell use and has the major advantage that iPSCs can potentially be derived from patient-specific...mutation and minimize tumorigenicity, an inherent disadvantage of iPS cell technology. Browse Addgene's collection...create cell lines with endogenously-tagged gene variants or browse Addgene’s entire collection of Stem ...and Xeno-Free Culture Conditions: A Clinically Compliant Approach. Stem Cells Transl Med. 2015 Mar 5. pii...Mouse Direct reprogramming of fibroblasts into antigen-presenting dendritic cells. Sci Immunol. 2018 Dec...Lentiviral Mouse Direct Induction of the Three Pre-implantation Blastocyst Cell Types from Fibroblasts. Cell... -
Tetracycline Inducible Expression
TypeCollection...hormones or metal ions, scientists have adapted an antibiotic resistance operon from E. coli : the tetracycline...elements like the H1 RNA promoter. And, most importantly, the TetR protein has been modified to provide...identify the amino acid residues of TetR that were important for tetracycline-dependent repression. Mutating...). rtTA3 and Tet-On 3G : further improved rtTA variants with lower background activity and greater sensitivity...#85972 for hygromycin selection. TetR H1-2O2 Cindy Miranti 104321 tet-pLKO-sgRNA-puro Lentiviral Tet-On plasmid...Lentiviral Tet-On inducible RNAi with miR-E (miR-30 variant)-based backbone rtTA-Advanced TRE3G Johannes Zuber... -
CRISPR Pooled gRNA Libraries
TypeCollection...collection differ based on some important criteria, and it is important to know which library best... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...with the pooled library to create a population of mutant cells that are then screened for a phenotype of...representation. CRISPR screening experiments require large quantities of cells and therefore, may not be suitable for...best suits your particular experiment. Some important variables include: Type of genetic modification - ... -
Lentivirus Plasmids
TypeCollection...both dividing and non-dividing cells without a significant immune response. These viruses also integrate...that encodes genetic material that the researcher wants delivered to specific target cells. This genome ... See article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion...destination plasmid for cDNA expression Ramalho-Santos 24129 pULTRA 3rd bi-cistronic expression of EGFP...fusion. See plasmids 36083 and 36086 for other FP variants. Tsoulfas 41393 pCW57.1 3rd Inducible lentiviral... -
Validated gRNA Sequences
TypeCollection...gRNA activity. Know your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this...compatible with a single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with...GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C. elegans GCTACCATAGGCACCACGAG...CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S.... -
Optogenetics AAV Preps
TypeCollection...other mutants Chronos, Chrimson, ChRmine, ChroME, ChETA, C1V1 (t/t) Inhibitory Arch and variants eNpHR...eNpHR and variants InSynC (non-opsin) Jaws WiChR stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter...AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know... -
Depositor Collections
TypeCollection...Collections Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection Disease...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression... Simpson Reagents for improved expression of recombinant phosphoproteins - Rinehart FreeGenes Project ... -
CRISPR Plasmids - Epigenetics
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...technologies also indirectly modify local chromatin state. Want more information on the wide variety of Cas enzymes...plasmids for epigenetic modification in mammalian or plant systems. Mammalian ID Plasmid Gene/Insert Promoter...Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication... -
CRISPR Plasmids - Repress Gene Expression
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...target the dCas9-repressor to your specific locus. Want more information on the wide variety of Cas enzymes... for expression in mammalian systems, bacteria, plants, and yeast. Mammalian ID Plasmid Gene/Insert Promoter... ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...target the dCas9-activator to your specific locus. Want more information on the wide variety of Cas enzymes...expression in mammalian systems, bacteria, Drosophila, plants, and yeast. Mammalian ID Plasmid Gene/Insert Promoter... ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker...