Skip to main content
Addgene

We narrowed to 132 results for: ANT;

Showing: 41 - 60 of 132 results
  1. Cancer Research Plasmids and Resources

    Type
    Collection
    ...publications, focused on somatic variants found in lung adenocarcinoma as well as variants found across cancer types... for use in cancer signaling studies, including mutant, knockdown, and overexpression constructs. Each...involved in cancer development. These pathways are important to normal cell signaling and physiology, and, ...location, their pathway dependencies are extremely important for classification and treatment. On each pathway...Meyerson , and Root Labs containing wild-type and mutant alleles described in the initial Target Accelerator...
  2. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...CRISPR systems, the most abundant type found in bacteria and archaea. While abundant in nature, Class 1 systems... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...double-strand break, either due to a boundary defined by anti-CRISPR proteins or running into other proteins bound... expression in mammalian systems, bacteria, and plants. Mammalian ID Plasmid Gene/Insert Promoter PI Publication... ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter PI Publication Last...
  3. Addgene Packaged on Request: Scope of Service

    Type
    Collection
    ...through our Packaged on Request service, Addgene guarantees a titer of at least 4 x 10 12 GC/mL for the AAV1... you know that we don’t expect to produce our guaranteed titer, and will give you the option to proceed...proceed with your order, or not, without a guaranteed titer. Any titer expectations communicated by email ...email will supersede the general guarantees above. We will have our expert viral vector production team carefully...our viral production does not yield the titer guaranteed here or by email, Addgene will contact you to...carried out with our materials, Addgene cannot guarantee the function of any viral vector. Addgene performs...
  4. Synthetic Biology - Overview

    Type
    Collection
    ... Standard European Vector Architecture Open Plant - Plant SynBio resource EraSynBio - The EU/USA SynBio...Mukhopadhyay Richard Murray Erin O'Shea Martin Parniske Antonio Richart Herbert Sauro Claudia Schmidt-Dannert Pamela...pairs. Browse Plasmids by Model Organism Bacterial Plant Yeast Mammalian Worm Fungal Algal Featured SynBio...FREQ-Seq Kit FX Cloning Kit GreenGate Cloning System (Plant) MoClo Modular Cloning Modular PUF Assembly Kit ...Kit Optogenetics Pertz Lab cpFRET Kit Rinehart Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway...
  5. AAV for Neuronal Tracing

    Type
    Collection
    ...pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies virus AAV1 Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA...AAV together can be used to complement deletion-mutant rabies virus AAV1 Wickersham 100799 pAAV-TREtight-mTagBFP2...the cell population of interest with a deletion-mutant tracing virus that lacks the ability to infect ... To enable monosynaptic spread of this deletion-mutant rabies, the essential G protein is provided to ...2007a. Retrograde neuronal tracing with a deletion-mutant rabies virus. Nat Methods. 4(1):47-9. PMID: 17179932... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...
  6. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...information. Plasmids Expressing Spike and Spike Variants Full-length wildtype SARS-CoV-2 spike protein ...D614G change which is present in many circulating variants. The table below lists expression plasmids that...protein (MERS, CoV-1, CoV-2), modification, or variant. ID Plasmid Description Mutations Industry PI Due...Addgene Blog Posts Viral Vectors 101: Pseudotyping Antibody Neutralization Response Against Pseudoviruses ...Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants Addgene COVID-19 Resources and Collections COVID-19 and...
  7. Retrovirus Plasmids

    Type
    Collection
    ...Large T antigen for creation of immortalized cells (see Weinberg Lab page for resistance variants) Weinberg...results in long-term transgene expression. Some disadvantages of γ-retroviruses are that they can only transduce... Plasmids Common γ-retroviral transfer plasmids. Want a retroviral plasmid with your gene of interest?...expression; also expresses GFP. Also see pMIG-w , a variant that has WRE, a post-transcriptional regulatory...
  8. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...
  9. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...collection differ based on some important criteria, and it is important to know which library best... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...with the pooled library to create a population of mutant cells that are then screened for a phenotype of...representation. CRISPR screening experiments require large quantities of cells and therefore, may not be suitable for...best suits your particular experiment. Some important variables include: Type of genetic modification - ...
  10. Plasmids for Stem Cell Research

    Type
    Collection
    ... to embryonic stem cell use and has the major advantage that iPSCs can potentially be derived from patient-specific...mutation and minimize tumorigenicity, an inherent disadvantage of iPS cell technology. Browse Addgene's collection...create cell lines with endogenously-tagged gene variants or browse Addgene’s entire collection of Stem ...and Xeno-Free Culture Conditions: A Clinically Compliant Approach. Stem Cells Transl Med. 2015 Mar 5. pii...Mouse Direct reprogramming of fibroblasts into antigen-presenting dendritic cells. Sci Immunol. 2018 Dec...Lentiviral Mouse Direct Induction of the Three Pre-implantation Blastocyst Cell Types from Fibroblasts. Cell...
  11. Lentivirus Plasmids

    Type
    Collection
    ...both dividing and non-dividing cells without a significant immune response. These viruses also integrate...that encodes genetic material that the researcher wants delivered to specific target cells. This genome ... See article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion...destination plasmid for cDNA expression Ramalho-Santos 24129 pULTRA 3rd bi-cistronic expression of EGFP...fusion. See plasmids 36083 and 36086 for other FP variants. Tsoulfas 41393 pCW57.1 3rd Inducible lentiviral...
  12. Optogenetics AAV Preps

    Type
    Collection
    ...other mutants Chronos, Chrimson, ChRmine, ChroME, ChETA, C1V1 (t/t) Inhibitory Arch and variants eNpHR...eNpHR and variants Jaws stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx EF1a...AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...
  13. Validated gRNA Sequences

    Type
    Collection
    ...gRNA activity. Know your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this...compatible with a single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with...GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C. elegans GCTACCATAGGCACCACGAG...CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S....
  14. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...depending if you want to use wildtype cas9 or double nickase). For example, if you want to target two genomic... et. al, 2013 Science paper. For example, if you want to use double nickase, you could express two spacers...the two plasmids together into your cells. If you want to use double nickase, you need to have four spacers...Cong et al. , Science 2013 for more details. One important note is that this ‘split RNA’ design is not as...
  15. Depositor Collections

    Type
    Collection
    ...Collections Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection Disease...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression... Simpson Reagents for improved expression of recombinant phosphoproteins - Rinehart FreeGenes Project ...
  16. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...technologies also indirectly modify local chromatin state. Want more information on the wide variety of Cas enzymes...plasmids for epigenetic modification in mammalian or plant systems. Mammalian ID Plasmid Gene/Insert Promoter...Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...
  17. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...target the dCas9-repressor to your specific locus. Want more information on the wide variety of Cas enzymes... for expression in mammalian systems, bacteria, plants, and yeast. Mammalian ID Plasmid Gene/Insert Promoter... ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker...
  18. CRISPR Plasmids - Activate Gene Expression

    Type
    Collection
    ... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...target the dCas9-activator to your specific locus. Want more information on the wide variety of Cas enzymes...expression in mammalian systems, bacteria, Drosophila, plants, and yeast. Mammalian ID Plasmid Gene/Insert Promoter... ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker...
  19. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...the collateral RNA degradation seen in bacteria. Want more information on the wide variety of Cas enzymes... expression in mammalian systems, bacteria, and plants. Mammalian ID Plasmid Gene/Insert Promoter Selectable...Bacterial ID Plasmid Gene/Insert PI Publication Plant ID Plasmid Gene/Insert PI Publication Do you have...
  20. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...HDR occurs at a much lower efficiency than NHEJ. Want more information on the wide variety of Cas enzymes...expression in mammalian systems, bacteria, Drosophila, plants, C. elegans, yeast, zebrafish, and Xenopus. Mammalian...Insert Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker...
Showing: 41 - 60 of 132 results