Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 138 results for: STI

Showing: 41 - 60 of 138 results

  1. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...teaching different types of courses, at any type of institution, and at different points in their careers to ...inexpensive to assay, and easy to purify using histidine-tagged constructs and routine protein and molecular...facilitates scientific collaborations between institutions. With these plasmids, faculty can begin a sustainable...watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic, glyoxysomal, mitochondrial, peroxisomal...

  2. mTOR Pathway

    Type
    Collection
    ...Pathway Plasmids mTOR Gene List Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is...known as STK11; serine/threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40...Mitogen-activated protein kinase associated protein 1 mTOR Mechanistic target of rapamycin p53 TP53; tumor protein p53...nrd4505. PubMed PMID: 25743081 . Do you have suggestions for other plasmids that should be added to this...

  3. Microbiology Resources

    Type
    Collection
    ...plasmids Addgene distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases...Synechococcus sp. Thermus sp. Vibrio sp. Yersinia pestis Plasmids for Cyanobacteria Cyanobacteria Plasmids...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...opens in a new window) Return to top Do you have suggestions for other plasmids that should be added to this...

  4. Neurodegeneration Research Collection

    Type
    Collection
    ...years from symptom onset. Disease mechanisms are still poorly understood but several genes and mapped loci...other large scale studies. Researchers are now investigating the role that these additional genes may play...Noteworthy: Study aberrant axon initial segment (AIS) plasticity with a motor neuron-specific reporter and a PAX7...accelerate discovery and advance development of diagnostics and treatments for Alzheimer’s disease and related...

  5. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...sgRNA(F+E) 59986 Other/Ciona intestinalis BsaI none S. pyogenes Christiaen p(U6a-BsaI-gRNA) 65955 Other...Golden Gate cloning or the Gibson Assembly. Chen Boosting CRISPR/Cas9 multiplex editing capability with ...into Tol2-based pGGDestTol2LC vector. Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen...genes in Escherichia coli. Koffas Do you have suggestions for other plasmids that should be added to this...

  6. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ... using modular components or take advantage of existing GFP-lines for cell-specific manipulation. Plasmids...Plasmids Fluorescent Protein Purpose Principal Investigator Plasmids GFP GFP-dependent transcription factors...activity Michael Lin See Plasmids Do you have suggestions for other plasmids that should be added to this...

  7. Cre-lox system

    Type
    Collection
    ...Eisenhoffer 131783 pTol2-CreLite CreLite; Tol2 destination vector with mTagBFP2 Zebrafish Eisenhoffer 131785...constructs Cre-loxP recombination is used to create a stochastic choice of expression among fluorescent proteins...indelible marking of mouse neurons with multiple distinct colors Mammalian Sanes See article Multibow constructs...which reporters are initially OFF and then probabilistically ON or OFF following Cre recombination to maximize....0403954101. Epub 2004 Jul 6. PubMed . Do you have suggestions for other plasmids that should be added to this...

  8. AAV Viral Preps

    Type
    Collection
    ...includes titering, purity assessment, sterility testing, and viral genome sequencing (VGS). In-stock AAV...Neuronal Tracing Rabies Virus-Based Serotype Serotype Testing Samples Small samples of control AAV vectors for...CAP-B10, CAP-B22 University of Florida Serotype Testing Panel for the Eye and Brain For enhanced transduction...

  9. Mammalian RNAi Tools

    Type
    Collection
    ...interference (RNAi) experiments at Addgene; browse by constitutive lentiviral shRNA, cre-regulated lentiviral shRNA... silencing mechanism. It is a useful tool to investigate the roles of specific genes or to knockdown genes...retroviral and AAV backbone options. Plasmids for constitutive expression as well as those that allow for conditional...

  10. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...NPY2R Human Mouse IgG2a 177465 Anti-Collybistin [L120/30R] Collybistin Rat Mouse IgG2a 177466 Anti-nNOS/...Alpha1 Human Mouse IgG2a 177575 Anti-Collybistin [L120/12R] Collybistin Rat Mouse IgG2a 182096 Anti-Kv2.1...IgG2a 225365 Collybistin (Rattus norvegicus) recombinant monoclonal antibody. Collybistin Rat Mouse IgG2a...BAIAP2 Human Mouse 190507 Collybistin scFv [L120/12] L120/12 scFv Collybistin Rat Mouse 190508 Bassoon ...R-mAbs have been engineered such that they are a distinct IgG subclass from the conventional mAb to facilitate...

  11. Synthetic Biology - Overview

    Type
    Collection
    ...Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium ...ethical synthetic biology JBEI - Joint Bio-Energy Institute Synberc - Synthetic Biology Engineering Research...Synthetic Biology - Open access journal Do you have suggestions for other plasmids that should be added to this...

  12. Worm Expression Resources

    Type
    Collection
    ...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...on miniMos and MosSCI plasmids can be found on Christian Frøkjær-Jensen's Wormbuilder website. General ...organism C. elegans. Return to top Do you have suggestions for other plasmids that should be added to this...

  13. Validated gRNA Sequences

    Type
    Collection
    ...Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740 Christiaen EGFP A. victoria...negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740 Christiaen negative control...

  14. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...changed the way researchers can explore important questions surrounding serine phosphorylation by adding this...improved phosphoprotein yield, rEcoli growth characteristics, and an overall improved ease of use when expressing...precise knowledge of phosphorylated positions for testing phosphoproteomics methods, proteomics search algorithms...

  15. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Genetics 2014 Allen Institute for Cell Science Plasmid Collection The Allen Institute for Cell Science has...and EGFP are available at Addgene. Do you have suggestions for other plasmids that should be added to this...

  16. Retrograde AAV viral preps

    Type
    Collection
    ...construct from Alla Karpova at Janelia Research Institute....staining, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...vector preparation. In some cases, in vivo testing of these viral preparations was performed by the Karpova...

  17. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...For small deletions (as the “deletion band” may still amplify), resolve agarose gel to determine if size...for 20 min). These cycling conditions allow for digestion and ligation to occur in one reaction (see step...conditions for each primer pair designed based on testing the bulk sorted cells. Run samples on 2% agarose...

  18. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout ...Mutation Libraries 229137–229140 Donor Vector Human Stiewe N/A Varies 1,910–3,034 per exon Human Cas13 lncRNA...69,716 SAM v2 - 2 plasmid system 1000000078 (Blasticidin) Activation Human Zhang 3rd 3 70,290 sgRNA libraries...

  19. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Fluorescent Protein Resources: Empty Backbones Allen Institute for Cell Science Plasmid Collection FRET Biosensors...-pmCherryC1 Actin Filaments Cortactin mCherry Christien Merrifield 36201 pLifeAct-mTurquoise2 Actin Filaments...Protein Collection . Return to top Do you have suggestions for other plasmids that should be added to this...

  20. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...partnership to provide AAV viral preps, includes listing of transfer status for viral preps....Discontinued Penn Vector Core Viral Vectors (Plasmids still available, other serotypes may be available) Based...Wilson Please contact [email protected] with any questions. Return to top...
Showing: 41 - 60 of 138 results