Skip to main content

We narrowed to 136 results for: STI

Showing: 41 - 60 of 136 results
  1. mTOR Pathway

    Type
    Collection
    ...Pathway Plasmids mTOR Gene List Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is...known as STK11; serine/threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40...Mitogen-activated protein kinase associated protein 1 mTOR Mechanistic target of rapamycin p53 TP53; tumor protein p53...nrd4505. PubMed PMID: 25743081 . Do you have suggestions for other plasmids that should be added to this...
  2. Microbiology Resources

    Type
    Collection
    ...plasmids Addgene distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases...Synechococcus sp. Thermus sp. Vibrio sp. Yersinia pestis Plasmids for Cyanobacteria Cyanobacteria Plasmids...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...opens in a new window) Return to top Do you have suggestions for other plasmids that should be added to this...
  3. Neurodegeneration Research Collection

    Type
    Collection
    ...years from symptom onset. Disease mechanisms are still poorly understood but several genes and mapped loci...other large scale studies. Researchers are now investigating the role that these additional genes may play...Noteworthy: Study aberrant axon initial segment (AIS) plasticity with a motor neuron-specific reporter and a PAX7...accelerate discovery and advance development of diagnostics and treatments for Alzheimer’s disease and related...
  4. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...sgRNA(F+E) 59986 Other/Ciona intestinalis BsaI none S. pyogenes Christiaen p(U6a-BsaI-gRNA) 65955 Other...Golden Gate cloning or the Gibson Assembly. Chen Boosting CRISPR/Cas9 multiplex editing capability with ...into Tol2-based pGGDestTol2LC vector. Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen...genes in Escherichia coli. Koffas Do you have suggestions for other plasmids that should be added to this...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Parkinson's Christien Merrifield 27700 Hip1R-tDimerRFP-N1 Hip1R RFP CMV Parkinson's Christien Merrifield...Hurley 237478 pLCKO-CMV-TMEM106B-P2A-Blasticidin TMEM106B P2A, Blasticidin CMV Frontotemporal dementia in GRN...pLCKO-CMV-TMEM106B-M210A_F213A-P2A-Blasticidin TMEM106B P2A, Blasticidin CMV Frontotemporal dementia in GRN...Pellman 238130 pLCKO-CMV-Blasticidin-P2A-3xHA-TMEM106B_Human TMEM106B P2A, Blasticidin, HA CMV Frontotemporal...Daelemans 238133 pLCKO-CMV-Blasticidin-P2A-3xHA-TMEM106B_Mouse TMEM106B P2A, Blasticidin, HA CMV Frontotemporal...ClinVar) and is meant to be representative but not exhaustive. If you do not see a particular gene of interest...114410 AICSDP-64: FUS-mEGFP FUS GFP ALS Allen Institute for Cell Science 114601 pTWIN1-His6-Ssp-Htt18-...
  6. AAV Viral Preps

    Type
    Collection
    ...includes titering, purity assessment, sterility testing, and viral genome sequencing (VGS). In-stock AAV...Neuronal Tracing Rabies Virus-Based Serotype Serotype Testing Samples Small samples of control AAV vectors for...CAP-B10, CAP-B22 University of Florida Serotype Testing Panel for the Eye and Brain For enhanced transduction...
  7. Mammalian RNAi Tools

    Type
    Collection
    ...interference (RNAi) experiments at Addgene; browse by constitutive lentiviral shRNA, cre-regulated lentiviral shRNA... silencing mechanism. It is a useful tool to investigate the roles of specific genes or to knockdown genes...retroviral and AAV backbone options. Plasmids for constitutive expression as well as those that allow for conditional...
  8. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...NPY2R Human Mouse IgG2a 177465 Anti-Collybistin [L120/30R] Collybistin Rat Mouse IgG2a 177466 Anti-nNOS/...Alpha1 Human Mouse IgG2a 177575 Anti-Collybistin [L120/12R] Collybistin Rat Mouse IgG2a 182096 Anti-Kv2.1...IgG2a 225365 Collybistin (Rattus norvegicus) recombinant monoclonal antibody. Collybistin Rat Mouse IgG2a...BAIAP2 Human Mouse 190507 Collybistin scFv [L120/12] L120/12 scFv Collybistin Rat Mouse 190508 Bassoon ...R-mAbs have been engineered such that they are a distinct IgG subclass from the conventional mAb to facilitate...
  9. Synthetic Biology - Overview

    Type
    Collection
    ...Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium ...community-created BioBricks JBEI - Joint Bio-Energy Institute Synberc - Synthetic Biology Engineering Research...Synthetic Biology - Open access journal Do you have suggestions for other plasmids that should be added to this...
  10. Worm Expression Resources

    Type
    Collection
    ...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...on miniMos and MosSCI plasmids can be found on Christian Frøkjær-Jensen's Wormbuilder website. General ...organism C. elegans. Return to top Do you have suggestions for other plasmids that should be added to this...
  11. Validated gRNA Sequences

    Type
    Collection
    ...Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740 Christiaen EGFP A. victoria...negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740 Christiaen negative control...
  12. COVID-19 Resources

    Type
    Collection
    ...credit: Maya Kostman for the Innovative Genomics Institute The Coronavirus Disease-2019 (COVID-19) pandemic...2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: DETECTR (Link opens in a new window) SHERLOCK...last reviewed on 26 September 2025. Do you have suggestions for other plasmids that should be added to this...
  13. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Genetics 2014 Allen Institute for Cell Science Plasmid Collection The Allen Institute for Cell Science has...and EGFP are available at Addgene. Do you have suggestions for other plasmids that should be added to this...
  14. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...changed the way researchers can explore important questions surrounding serine phosphorylation by adding this...improved phosphoprotein yield, rEcoli growth characteristics, and an overall improved ease of use when expressing...precise knowledge of phosphorylated positions for testing phosphoproteomics methods, proteomics search algorithms...
  15. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...them. Most SSR enzymes are categorized into two distinct families, serine recombinases and tyrosine recombinases...Expression of both fragments in the same cell reconstitutes a functional protein, allowing recombination...Content last reviewed on 31 July 2025. Do you have suggestions for other plasmids that should be added to this...
  16. Retrograde AAV viral preps

    Type
    Collection
    ...construct from Alla Karpova at Janelia Research Institute....staining, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...vector preparation. In some cases, in vivo testing of these viral preparations was performed by the Karpova...
  17. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout ...Mutation Libraries 229137–229140 Donor Vector Human Stiewe N/A Varies 1,910–3,034 per exon Human Cas13 lncRNA...69,716 SAM v2 - 2 plasmid system 1000000078 (Blasticidin) Activation Human Zhang 3rd 3 70,290 sgRNA libraries...
  18. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...-pmCherryC1 Actin Filaments Cortactin mCherry Christien Merrifield 36201 pLifeAct-mTurquoise2 Actin Filaments...Collection . Return to top Additional Resources Allen Institute for Cell Science Plasmid Collection Michael Davidson...Addgene Blog: Fluorescent Proteins Do you have suggestions for other plasmids that should be added to this...
  19. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...partnership to provide AAV viral preps, includes listing of transfer status for viral preps....Discontinued Penn Vector Core Viral Vectors (Plasmids still available, other serotypes may be available) Based...Wilson Please contact [email protected] with any questions. Return to top...
  20. Neuroscience

    Type
    Collection
    ...Reactivity Recommended Applications PI Do you have suggestions for other antibodies that should be added to ... represent the official views of the National Institutes of Health....
Showing: 41 - 60 of 136 results