Skip to main content
Addgene
Showing: 41 - 58 of 58 results

  1. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...cutting enzymes: NotI at the 5' end and AscI at the 3' end. These inserts can then be sub-cloned into a ...benchmarked protein microarray-based platform for the identification of novel low-affinity extracellular protein...

  2. Caltech Systemic Capsids

    Type
    Collection
    ... work in your mouse line, see Supplementary Table 3 (Link opens in a new window) . Browse Available PHP.eB...Inhibitory - AAV-PHP.eB with GRE or transgenic animal L2/3 & L4 - AAV.CAP-B10 with GRE or transgenic animal Excitatory...PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent...Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-...Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent...Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2...Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10...

  3. Cre-lox system

    Type
    Collection
    ...Cre lac Bacterial Ekker 47551 pDD104 (Peft-3::Cre) Cre eft-3 C. elegans Goldstein 48201 CAG-GFP-IRES-CRE...deltaG)-Cre Cre CMV RABV Jessell 73717 pMLS328 Cre eft-3 C. elegans Jorgensen 75267 pAAV-CIBN-CreC photo-activatable...Vivo Electroporation. Proc Natl Acad Sci. Jan 16;104(3):1027-32. doi: 10.1073/pnas.0610155104. Epub 2007 ...recognizes 34 bp loxP sites, and the orientation and location of the loxP sites determines how the genetic material...of rearrangements: inversion, deletion, and translocation. Figure 1. Recombination outcomes are determined...are on separate DNA molecules (in trans), a translocation event is generated between the target sites....present. By expressing Cre at specific times or locations, you can precisely control expression of your ...

  4. AAVED

    Type
    Collection
    ...Combinatorial Strategies Connie Cepko 2:45 PM Break 3:00 PM (Group Discussion) Technologies and Resources...contribute to this publication. Citation information for openly shared communication: Adeno-Associated ...Addgene's 2018 AAV Education and Development (AAVED) workshop series. The... The AAV Education and Development ...Details Date: Friday September 21, 2018, 9 AM - 5 PM Location: Addgene, 75 Sidney St, Cambridge, MA, 02139 Organizing...useful to help improve this technology or its application? What are some current obstacles that researchers...prepare and compile resources for this meeting's publication, we are asking participants to share practical...

  5. Worm Expression Resources

    Type
    Collection
    ...genetic model organism due to their rapid life cycle (3 days from egg to adult) and easy lab maintenance. ...Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. ...consortium of biologists and computer scientists dedicated to providing the research community with accurate...

  6. Brain Initiative Collection

    Type
    Collection
    ...Fishell 83898-AAV1 pAAV-mDlx-ChR2-mCherry-Fishell-3 ChR2-mCherry fusion expression in forebrain GABA-ergic...Fishell 83898-AAV9 pAAV-mDlx-ChR2-mCherry-Fishell-3 ChR2-mCherry fusion expression in forebrain GABA-ergic...Fishell 83898-AAVrg pAAV-mDlx-ChR2-mCherry-Fishell-3 ChR2-mCherry fusion expression in forebrain GABA-ergic... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ...Gradinaru 105448-AAV9 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Cation channelrhodopsin ChrimsonR fused to mRuby2 fluorophore...108912-AAV9 pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3 Cation channelrhodopsin ChroME targeted to the neuronal...

  7. Bacterial Expression Systems

    Type
    Collection
    ... rpoZ- on plates lacking histidine and containing 3-AT Scot Wolfe Bacterial one-hybrid system for testing...promotes growth on plates lacking His and containing 3-AT. FLIParaF.Ec-250n 18855 N/A FRET between CFP and...Genome Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter...Reporter Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may...Bacteria? E. coli are commonly used to store and replicate plasmids of all types, but beyond that, researchers...sites within this plasmid. Return to Top Protein Purification Sometimes looking at a protein inside cells ...and, epitope tags can be used to simplify the purification process. Using plasmids in this collection, ...

  8. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-3486-3. PubMed . Promoter-associated proteins of EPAS1 identified...of a catalytically inactive form of Cas9 (dCas9) plus guide RNA (gRNA) for biochemical purification (Fig...protein such as LexA are subjected to affinity purification (Fig. 1). In enChIP, specific genomic regions...537-548. doi: 10.1093/dnares/dsx023. PubMed . Identification of physical interactions between genomic regions...10.1111/gtc.12341. Epub 2016 Feb 5. PubMed . Identification of non-coding RNAs associated with telomeres...26. doi: 10.1186/s12867-014-0026-0. PubMed . Identification of proteins associated with an IFNgamma-responsive...Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding...

  9. Lentivirus Plasmids

    Type
    Collection
    ...shRNA cassettes into the unique SnaBI site in the 3´-LTR). See here for other versions of pULTRA. Moore...included to monitor expression Parijs 11619 pLB 3rd Modification of pLL3.7; Genetic elements known to prevent...

  10. Neurodegeneration Research Collection

    Type
    Collection
    ... and breathing, and often results in death within 3-5 years from symptom onset. Disease mechanisms are...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority... consists mainly of managing symptoms through medication and surgery. PD primarily involves the malfunction...available from Addgene, sortable by type of genetic modification and target species. You can also find our guide...Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation kinetics and localization...A multicolor atlas for whole-brain neuronal identification in C. elegans. Yemini et al. Cell. 2021 Jan...window) A news website and information resource dedicated to helping researchers accelerate discovery and...

  11. COVID-19 Resources

    Type
    Collection
    ...contains a potential cleavage site for furin proteases.( 3 ) BSG - (CD147), transmembrane glycoprotein of the... CD147-spike protein . Cathepsin L - Bosch BJ, et al, 2008, J Virol. Cathepsin L Functionally Cleaves ... is involved in virus entry into cells. ( 4 ) Cathepsin L - a cysteine endosomal protease that triggers...Andrew Ellington's lab. High-surety isothermal amplification and detection of SARS-CoV-2, including with ...

  12. Rett Syndrome

    Type
    Collection
    ...: a review of the epidemiology. J Pediatric . 148(3):347-352. (Link opens in a new window) PMID: 16615965... disruptions, missense mutations located in the MBD, and truncations prior to the NID are more severe ...even within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor...Line Mutation (DNA) Background Strain Purpose Publication PI Mecp2 NLucTom Knock-in of NLuc-tdTomato at...DNA) Mutation (protein) Sex Source of Material Publication PI N126I A377T N126I M Fibroblasts & iPSC (Link...

  13. Retrograde AAV viral preps

    Type
    Collection
    ...Optogenetics Boyden 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx Activator Optogenetics Fishell 65014 pAAV-hsyn-Jaws-KGC-GFP-ER2...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...

  14. Optogenetics AAV Preps

    Type
    Collection
    ...1, 9 Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell 135634...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...

  15. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Circuits through the Parafascicular Nucleus. Neuron 102(3):636-652. PubMed (Link opens in a new window) Marcinkiewcz...inhibitory opsins , genetically-encoded calcium indicators, and rabies targeting genes. Recombinases Addgene...

  16. Validated gRNA Sequences

    Type
    Collection
    ...that are upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...

  17. Antibody Guide

    Type
    Collection
    ... a protein’s presence or absence. Figure 3: A western blot detecting proteins using the indirect detection...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...

  18. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Spinocerebellar ataxia 22 Bernard Weinstein 21238 PKC gamma CAT PRKCG HA CMV Spinocerebellar ataxia 21 Bernard Weinstein...TLS 2: hTLS.pCDNA1 FUS CMV ALS David Ron 21829 TLS 3: TLS.pRSET.C FUS His T7 ALS David Ron 21830 TLS 4:... APEX2 CMV Parkinson's Mark Cookson 165107 pGEX4T-3-6AOptParkin PRKN GST tac Parkinson's Arthur Haas 166671...dementia (FTD) Thomas Kukar 176922 pcDNA3.1(+)_Granulin 3+linker4 GRN Flag, Strep CMV Frontotemporal dementia...dementia (FTD) Thomas Kukar 176923 pcDNA3.1(+)_Granulin 3-no linker GRN Flag, Strep CMV Frontotemporal dementia... HA CMV ALS Catherine Tomasetto 104450 pEGFPC1-hVAP-B KD/MD VAPB GFP, HA CMV ALS Catherine Tomasetto 104465...
Showing: 41 - 58 of 58 results