Skip to main content

We narrowed to 49 results for: cat.3

Showing: 41 - 49 of 49 results
  1. Neurodegeneration Research Collection

    Type
    Collection
    ... and breathing, and often results in death within 3-5 years from symptom onset. Disease mechanisms are...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority... consists mainly of managing symptoms through medication and surgery. PD primarily involves the malfunction...available from Addgene, sortable by type of genetic modification and target species. You can also find our guide...Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation kinetics and localization...A multicolor atlas for whole-brain neuronal identification in C. elegans. Yemini et al. Cell. 2021 Jan...window) A news website and information resource dedicated to helping researchers accelerate discovery and...
  2. Lentivirus Plasmids

    Type
    Collection
    ...shRNA cassettes into the unique SnaBI site in the 3´-LTR). Find more pULTRA versions . Malcolm Moore 25895... plasmids to express a CRISPR gRNA? Browse our catalog for lentiviral CRISPR plasmids for gRNA expression...monitor expression. Luk Parijs 11619 pLB 3rd Modification of pLL3.7 with added genetic elements known ...3rd For barcoding transcription factors for identification in pooled screens. Part of the MORF Collection...
  3. Rett Syndrome

    Type
    Collection
    ...: a review of the epidemiology. J Pediatric . 148(3):347-352. (Link opens in a new window) PMID: 16615965... disruptions, missense mutations located in the MBD, and truncations prior to the NID are more severe ...even within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor...Line Mutation (DNA) Background Strain Purpose Publication PI Mecp2 NLucTom Knock-in of NLuc-tdTomato at...DNA) Mutation (protein) Sex Source of Material Publication PI N126I A377T N126I M Fibroblasts & iPSC (Link...
  4. Retrograde AAV viral preps

    Type
    Collection
    ...Edward Boyden 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx Activator Optogenetics Gordon Fishell 65014 pAAV-hsyn-Jaws-KGC-GFP-ER2...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP Control Edward Boyden...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  5. Optogenetics AAV Preps

    Type
    Collection
    ...Karel Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Gordon Fishell...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  6. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Circuits through the Parafascicular Nucleus. Neuron 102(3):636-652. PubMed (Link opens in a new window) Marcinkiewcz...inhibitory opsins , genetically-encoded calcium indicators, and rabies targeting genes. Recombinases Addgene...
  7. Validated gRNA Sequences

    Type
    Collection
    ...that are upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...
  8. Antibody Guide

    Type
    Collection
    ... a protein’s presence or absence. Figure 3: A western blot detecting proteins using the indirect detection...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...
  9. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Spinocerebellar ataxia 22 Bernard Weinstein 21238 PKC gamma CAT PRKCG HA CMV Spinocerebellar ataxia 21 Bernard Weinstein...TLS 2: hTLS.pCDNA1 FUS CMV ALS David Ron 21829 TLS 3: TLS.pRSET.C FUS His T7 ALS David Ron 21830 TLS 4:... APEX2 CMV Parkinson's Mark Cookson 165107 pGEX4T-3-6AOptParkin PRKN GST tac Parkinson's Arthur Haas 166671...dementia (FTD) Thomas Kukar 176922 pcDNA3.1(+)_Granulin 3+linker4 GRN Flag, Strep CMV Frontotemporal dementia...dementia (FTD) Thomas Kukar 176923 pcDNA3.1(+)_Granulin 3-no linker GRN Flag, Strep CMV Frontotemporal dementia... FUS His T7 ALS Nicolas Fawzi 226605 FUS LC 4S->A#3 FUS His T7 ALS Nicolas Fawzi 226606 FUS LC 8Y->S FUS... HA CMV ALS Catherine Tomasetto 104450 pEGFPC1-hVAP-B KD/MD VAPB GFP, HA CMV ALS Catherine Tomasetto 104465...
Showing: 41 - 49 of 49 results