Skip to main content
Addgene
Showing: 1 - 16 of 16 results

  1. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...of basal H 2 O 2 levels with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with...Belousov Hydrogen Peroxide (H 2 O 2 ) Cytosolic or mitochondrial sensor for H 2 O 2 oxidation (roGFP2-Orp1) ...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET ...peroxiredoxin-2-based probe. Nat Commun. 2018 Aug 7;9(1):3145. Hadley Sikes Hydrogen Peroxide (H 2 O 2 ) Monitoring...Indicators to Image Dynamic Zn(2+) Secretion of Pancreatic Islets. Anal Chem. 2019 Oct 1;91(19):12212-12219. Huiwang...encoded Ca(2+) indicator with enhanced two-photon absorption. Neurophotonics. 2024 Apr;11(2):024207. doi...Calcium Red fluorescent calcium sensors (fRCaMP1/2, GECO1/2) The kinetic mechanisms of fast-decay red-fluorescent...

  2. p53 Pathway

    Type
    Collection
    ...CCNB1 CCNB2 CCNB3 Cyclin B1, 2, or 3 Cyclin D CCND1 CCND2 CCND3 Cyclin D1, 2, or 3 Cyclin E CCNE1 CCNE2 ...kinase 1 CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2 (RFWD2); E3 ubiquitin protein...SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2 TSP1 Thrombospondin... Spring Harbor Perspectives in Biology. 2010 Feb;2(2):a001107. PMC PMID: 20182618 . Do you have suggestions...p53 field. Brosh R, Rotter V. Nat Rev Cancer. 2009 Oct;9(10):701-13. PubMed PMID: 19693097 . The expanding...Menendez D, Inga A, Resnick MA. Nat Rev Cancer. 2009 Oct;9(10):724-37. PubMed PMID: 19776742 . Germline TP53...threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed 1; also known as GTSE1 BAI-1...

  3. Neurodegeneration Research Collection

    Type
    Collection
    ...between Rab12 and LRRK2 . Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries...target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. Target neural oxytocin receptors using an AAV-CRISPR...dopaminergic activity in vivo. Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop...study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study the C terminal domain of TDP-43 to better understand... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...

  4. Zhang Lab CRISPR Page

    Type
    Collection
    ....2013.08.021. Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the...Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub...2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. PubMed . Return to SpCas9 plasmids GeCKO Library...Jan;33(1):102-6. doi: 10.1038/nbt.3055. Epub 2014 Oct 19. PubMed . In vivo genome editing using Staphylococcus...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...

  5. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Other citations include...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Rosario, et al. 2016. ...AAV2 vectors in the mouse retina. Mol Ther . Feb;19(2):293-301. PMID: 21045809 Other citations include: ...

  6. Jaenisch Lab CRISPR Plasmids

    Type
    Collection
    ...Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Oct;23(10):1163-71. doi: 10.1038/cr.2013.122. Epub 2013...dCas9VP64 and sgRNA from separate promoters. Table 2. pmax dCas9 Activator Expression Plasmids ID Plasmid...

  7. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Transcription factor SOX-2 Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks...Rafelski SM, Gunawardane RN. Mol Biol Cell. 2017 Oct 15;28(21):2854-2874. doi: 10.1091/mbc.E17-03-0209...101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2 Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP... AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP-117 mEGFP RPB1 RNA polymerase...mEGFP AICSDP-77 mEGFP Telomeric repeat-binding factor 2 (TRF2) Telomeres 168799 CTCF-mEGFP AICSDP-144 mEGFP...

  8. Antibody Plasmid Collection

    Type
    Collection
    ...Tomlinson I+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...

  9. Tetracycline Inducible Expression

    Type
    Collection
    ...Pfleiderer K, Hillen W, Berens C. Biotechniques . 2004 Oct;37(4):546, 548, 550. PubMed . Optimization of the..., Klaver B, Berkhout B, Das AT. Gene Ther . 2006 Oct;13(19):1382-90. PubMed . Improved Tet-responsive ...expression tTA Off Verma 26803 pEnt L1L3 EF1a-tTA-2 Contains Gateway L1L3 sites and EF1α promoter driving...

  10. Plasmids for Stem Cell Research

    Type
    Collection
    ...Direct Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral Human...mouse somatic cells. Cell Stem Cell. 2008 Feb 7. 2(2):151-9. Jaenisch Lentivirus Mouse Polycistronic, ... 2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of human Klf4, Oct4, c-Myc, and Sox2...2013 Aug 1;13(2):246-54. Dowdy Adenovirus Mouse Non-integrating expression of mouse Sox2, Oct4, c-Myc, and...Developmental Potential of iPSCs. Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. Schöler You can also...reprogramming in mouse. Cell Stem Cell. 2008 Mar 6. 2(3):230-40. Hochedlinger MMLV-derived Retrovirus Mouse...Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic...

  11. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...Yuno M, Suzuki Y, Sugano S, Fujii H. DNA Res. 2017 Oct 1;24(5):537-548. doi: 10.1093/dnares/dsx023. PubMed...guide RNA (gRNA) for biochemical purification (Fig. 2). For additional information and protocols, check ... web page . Figure 1: iChIP general scheme Figure 2: enChIP general scheme Fujii Lab Plasmids Individual... of interest 85586 gRNA Cloning Vector Bbs I ver. 2 An empty sgRNA expression vector. sgRNA sequence can... into BbsI site. gRNA scaffold has efficient ver. 2 structure. 92220 pLenti_dCas9-2xAM Lentiviral plasmid...Mohlin S. Biochem Biophys Res Commun. 2018 May 5;499(2):291-298. doi: 10.1016/j.bbrc.2018.03.150. PubMed ...

  12. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...111707 Mode #2 Library (NEDD4 WW2 domain) Pooled Library 111708 Mode #2 Library (NEDD4-2 WW2 domain) References...Pooled Library 111705 Mode #2 Library (14-3-3β) Pooled Library 111706 Mode #2 Library (14-3-3σ) Pooled Library...Söll D, Isaacs FJ, Rinehart J. FEBS Lett . 2012. Oct 19;586(20):3716-22. PubMed (Link opens in a new window...phosphorylation-dependent protein-peptide interactions (“mode #2” expression, Barber et al, Nat. Biotech. 2018). The...fluorescence-activated cell sorting (FACS). The mode #2 phosphosite library with four different phosphobinding... WW2 domain of NEDD4, and the WW2 domain of NEDD4-2; 111705-8 ) is available from Addgene. Screening kinases...iSPI_pSer_Subpool#1 Pooled Library 188527 iSPI_pSer_Subpool#2 Pooled Library 188528 iSPI_pSer_Subpool#3 Pooled Library...

  13. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912... Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens ...GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere...

  14. Immunology Research Plasmids and Resources

    Type
    Collection
    ...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...HPS, HPS2, PE AZGP1 alpha-2-glycoprotein 1, zinc-binding ZA2G, ZAG B2M beta-2-microglobulin - CALR calreticulin...

  15. Genetic Code Expansion

    Type
    Collection
    ...48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Peter...Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73546 pEvol-pAzFRS.2.t1 pAzFRS.2.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial..._AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Simon...Mm-PylRS-AF/Pyl-tRNACUA PylRS M. mazei trans-cyclooct- 2-ene-lysine (TCOK) Mammalian TAG Howard Hang 126035...Jesse Rinehart 71403 pCMV-DnpK PylRS M. barkeri N6‐(2‐(2,4‐dinitrophenyl)acetyl)lysine (DnpK) Bacterial,...pDule-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally...

  16. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...- Bacterial Expression mScarlet-I3 568 592 68 4.2 2 min Monomer pmScarlet-I3_C1 - Mammalian Expression...pp. 7913–7923 Hoi et al. : Chemistry & Biology, October 2013, Vol. 20 No. 10, pp.1296-304 Kogure et al....
Showing: 1 - 16 of 16 results