We narrowed to 5 results for: Dnmt3a
-
TypeCollection...histone demethylation by LSD1 cytosine methylation by DNMT3A or MQ1 cytosine demethylation by Tet1 These modifications...
-
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR 71667...Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation S.... -
CRISPR Plasmids - Mammalian Expression
TypeCollection... demethylation by LSD1, cytosine methylation by DNMT3A or MQ1, and cytosine demethylation by Tet1. These... -
Validated gRNA Sequences
TypeCollection...Sabatini DNMT3A H. sapiens GAGATGATCGCCCCTTCTTC 41822 cut S. pyogenes 23287722 Church DNMT3A H. sapiens... -
CRISPR Guide
TypeCollection...TET1 - activation through cytosine demethylation DNMT3A - repression through cytosine methylation MQ1 -...labs , is an all-in-one dCas9 fusion with KRAB, DNMT3A, and DNMT3L. CRISPRoff maintains gene silencing...