We narrowed to 11 results for: Dnmt3a
-
TypeBlog Post...Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted...For lentiviral expression, Fuw-dCas9-Dnmt3a and Fuw-dCas9-Dnmt3a-P2A-tagBFP are available from Rudolf ...ready-to-use lentivirus. Figure 3: dCas9-DNMT3A methylates cytosines at promoters and enhancers...transient and quickly reversed in culture. However, DNMT3A-induced methylation persisted throughout a 100 ...
-
New CRISPR Web Resources and #12DaysofCRISPR Recap
TypeBlog Post... demethylation by LSD1, cytosine methylation by DNMT3A or MQ1, and cytosine demethylation by Tet1. RNA... -
Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation
TypeBlog Post...acetyltransferase p300 or the DNA methyltransferase DNMT3A allows researchers to easily add biochemical marks... -
CRISPR Plasmids - Epigenetics
TypeCollection...histone demethylation by LSD1 cytosine methylation by DNMT3A or MQ1 cytosine demethylation by Tet1 These modifications... -
Hot Plasmids: Summer 2024
TypeBlog Post...the endogenous, autoinhibited methyltransferase DNMT3A to the genomic location specified by the DNA-binding... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR 71667...Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation S.... -
CRISPR Plasmids - Mammalian Expression
TypeCollection... demethylation by LSD1, cytosine methylation by DNMT3A or MQ1, and cytosine demethylation by Tet1. These... -
Validated gRNA Sequences
TypeCollection...Sabatini DNMT3A H. sapiens GAGATGATCGCCCCTTCTTC 41822 cut S. pyogenes 23287722 Church DNMT3A H. sapiens... -
27 Hot Plasmids from 2016
TypeBlog Post...the catalytic domain from DNA methyltransferase, DNMT3A. Co-expression of this modified Cas9 along with... -
CRISPR Guide
TypeGuide...TET1 - activation through cytosine demethylation DNMT3A - repression through cytosine methylation MQ1 -...labs , is an all-in-one dCas9 fusion with KRAB, DNMT3A, and DNMT3L. CRISPRoff maintains gene silencing... -
CRISPR Guide
TypeCollection...TET1 - activation through cytosine demethylation DNMT3A - repression through cytosine methylation MQ1 -...labs , is an all-in-one dCas9 fusion with KRAB, DNMT3A, and DNMT3L. CRISPRoff maintains gene silencing...