...Sarcomeric thick filaments 124606 SOX2-mEGFP AICSDP-60 mEGFP Transcription factor SOX-2 Transcription Factor 124607...

...pluripotent state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Article PI Lentivirus Human Expression of human Oct4, Sox2, Klf4, Myc, and Brd3R from five separate lentiviral.... Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from four separate lentiviral... Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids...lentiviral vector for the expression of human Oct4, Sox2, and Klf4 Polycistronic lentiviral vector for "hit...lentiviral vector for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells ...for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming Reveal...

...23918387 Chen SOX17 H. sapiens GCCCAGCCCGGCCATCACCG 59725 cut S. pyogenes 25543152 Hanna Sox17 H. sapiens...24346702 Wolfe Sox17 H. sapiens GGAGGGGCAAGGGGCGGGCG 50924 activate S. pyogenes 24346702 Wolfe Sox17 H. sapiens...GGGCAAGTACGTCGATTCCA 50926 activate S. pyogenes 24346702 Wolfe Sox17 H. sapiens GGGCGTGGGCCTAACGACGC 50923 activate S...

...TTGTGTGTGTGTGTGTGTgtcagtgagcagcagcTCGCCACAGTGTTGGAGA sox1a TAL3366 & TAL3367 TATAGCATGATGATGGAAacggaccttcattcccCGGGACCCCAAACCAACA sox2 (site #1) ...TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA Sox2 (site #2) TAL3368 & TAL3369 TGGTGGGGTAGACTTTCGagaaaatcggtttaaaTGTATAACATGATGGAAA sox9b TAL3180...

... PX458_SAP130_1 PX458_SAP130_2 SOX5 Human FLAG pFETCh_SOX5 PX458_SOX5_1 SP5 Human FLAG pFETCh_SP5 PX458...

...CAG Mammalian Miyanari 140760 Sox1(2A-Cre) Cre; Targeting vector for Sox1 locus CAG Mammalian Okano 153207...iCre and tdTomato mfap4 Zebrafish Tobin 135618 pAAV-Sox2-CreERT2 Cre-ERT2 - Tamoxifen inducible; AAV donor...

...chemokine (C-X-C motif) ligand 16 CXCLG16, SR-PSOX, SRPSOX CXCL17 chemokine (C-X-C motif) ligand 17 DMC...