Skip to main content
Addgene

We narrowed to 21 results for: dTomato

Showing: 1 - 20 of 21 results
  1. Brain Initiative Collection

    Type
    Collection
    ...83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV2 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV5 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV9 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAVrg pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83896-AAV1 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...83896-AAV9 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...
  2. Chemogenetics AAV Preps

    Type
    Collection
    ...83896 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Fishell 83897...83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Fishell 50472...Deisseroth 135635 pAAV-S5E2-Gq-P2A-dTomato hM3D(Gq) - Activation dTomato (physically separate) none 1, 9,... tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity Cre-dependent Flp-dependent Cre and Flp-dependent...
  3. Retrograde AAV viral preps

    Type
    Collection
    ...Control Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP...107738 pAAV-hSyn-Cre-P2A-dTomato Syn Cre expression with simultaneous dTomato expression Recombinases ...AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f and physically separate nuclear dTomato Calcium sensor Ting 51083...-DIO-GCaMP6f-P2A-nls-dTomato EF1a GCaMP6f and physically separate nuclear dTomato, Cre-dependent Calcium...AAV-hSyn1-GCaMP6s-P2A-nls-dTomato Syn GCaMP6s and physically separate nuclear dTomato Calcium sensor Ting 100853...pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hDlx Inhibitor DREADD Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 ...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP ...
  4. Caltech Systemic Capsids

    Type
    Collection
    ...BiLAMP5e3 dTomato/nlsdTomato Control Fishell 213936 pAAV_BiPVe4_dTomato_nlsdTomato BiPVe4 dTomato/nlsdTomato...Control AIBS , Ting 213814 pAAV_BiSSTe10_dTomato_nlsdTomato BiSSTe10 dTomato/nlsdTomato Control Fishell 213829...213829 pAAV_BiCHATe27_dTomato_nlsdTomato BiCHATe27 dTomato/nlsdTomato Control Fishell 213855 pAAV_BiVIPe4...BiVIPe4 dTomato/nlsdTomato Control Fishell 213914 pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato BiLAMP5e3...Control Fishell 213940 pAAV_BiPVe3_dTomato_nlsdTomato BiPVe3 dTomato/nlsdTomato Control Fishell 213944...213944 pAAV_BiSSTe4_dTomato_nlsdTomato BiSSTe4 dTomato/nlsdTomato Control Fishell Chemogenetics 44361 pAAV-hSyn-DIO-hM3D...135630 pAAV-S5E2-dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP...
  5. Brain Armamentarium

    Type
    Collection
    ...Gradinaru 213944-PHPeB pAAV_BiSSTe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...Gradinaru 213940-PHPeB pAAV_BiPVe3_dTomato_nlsdTomato AAV construct expressing dTomato driven by PV+ basket...Gradinaru 213936-PHPeB pAAV_BiPVe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by chandelier...213914-PHPeB pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato AAV construct expressing dTomato driven by Lamp5...Gradinaru 213855-PHPeB pAAV_BiVIPe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by VIP interneuron-targeting...Gradinaru 213829-PHPeB pAAV_BiCHATe27_dTomato_nlsdTomato AAV construct expressing dTomato driven by cholinergic...Gradinaru 213814-PHPeB pAAV_BiSSTe10_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...
  6. Biosensor AAV Preps

    Type
    Collection
    ...-nls-dTomato EF1a GCaMP6f dTomato Cre dependent rg* Ting 51085 AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f...Rose 51082 AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato EF1a GCaMP6s dTomato Cre dependent 1 Ting 105714 pAAV-Ef1a-fDIO-GCaMP6s...Larsen 51084 AAV-hSyn1-GCaMP6s-P2A-nls-dTomato Syn GCaMP6s dTomato Constitutive 1, rg* Ting 68717 pAAV-CAG-Flex-mRuby2... GCaMP6f dTomato Constitutive 1, rg* Ting 52924 pZac2.1 gfaABC1D-lck-GCaMP6f GfaABC1D GCaMP6f none Constitutive...
  7. Recombinases AAV Preps

    Type
    Collection
    ... mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato Syn dTomato 1, 2, 5, 8, 9, rg*, PHPeB Larsen 107787 AAV.TBG.PI.Cre.rBGe...pAAV-EF1a-C-CreintG EF1a none 1 Cepko 69916 pAAV.cTNT.iCre cTnT tdTomato 9 Pu 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5...
  8. Control AAV Preps

    Type
    Collection
    ...9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Fishell...Deisseroth 135630 pAAV-S5E2-dTom-nlsdTom E2 regulatory dTomato Constitutive 1, 9, PHP.eB Dimidschstein 135631 ...AAV9-X1.1 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...dependent 2 Kole 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 197200...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...
  9. AAV Molecular Tools

    Type
    Collection
    ...paavCAG-post-mGRASP-2A-dTomato CAG-driven, constitutive Expression of post-synaptic mGRASP-dTomato for synaptic ... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals.... Liqun Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent expression...Na+ channel mNaChBac and (physically separate) tdTomato 8 Massimo Scanziani 34910 paavCAG-pre-mGRASP-mCerulean...
  10. Lentivirus Plasmids

    Type
    Collection
    ... and EGFP co-expression. See plasmid 21374 for dtomato version. Welm 21916 Tet-pLKO-neo 3rd inducible ...
  11. Luciferase Plasmid Collection

    Type
    Collection
    ...Lentiviral expression of firefly luciferase and dTomato. A gene of interest can also be inserted into the...
  12. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...
  13. Optogenetics AAV Preps

    Type
    Collection
    ...ChrimsonR tdTomato Cre dependent 1, 5 Boyden 62726 pAAV-Syn-Chronos-tdTomato Syn Chronos tdTomato Constitutive...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR... 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Boyden 100049 pAAV.hSynap.ChETA...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669...
  14. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...100048-AAV1 pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-9-ALL856 100048-AAV9 pAAV.CAG.LSL.tdTomato Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Optogenetics Ed Boyden AV-5-PV2527 99039-AAV5 ... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...
  15. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian... Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Jump to Top Red Protein Excitation (nm) Emission...
  16. Bacterial Expression Systems

    Type
    Collection
    ...18084 54856 pBad-mAmetrine1.1 tdTomato-pBAD mAmetrine1.1 (donor) tdTomato (acceptor) FRET/Dual FRET Robert... 54571 54856 mT-Sapphire-pBAD tdTomato-pBAD mT-Sapphire (donor) tdTomato (acceptor) FRET Robert Campbell...Parish 24657 pASTA3 Promoter activity Fluorescence (tdTomato) Mycobacterium sp. Tanya Parish 24658 pCHARGE3...
  17. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Dorus Gadella 37351 pQC membrane TdTomato IX Membrane Palmitoylation TdTomato Connie Cepko 22479 FUmGW Membrane...118737 pBOB-CARMIL2 BH domain-tdTomato Plasma Membrane CARMIL2 BH domain tdTomato John Cooper *Fusions to other...
  18. Rett Syndrome

    Type
    Collection
    ...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell...
  19. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 58112 tdTomato-MAPTau-C-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58113 tdTomato-MAPTau-...TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 ...tdTomato-MAPTau-N-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan...'s Ophir Shalem 215721 pDual-IN-SMN1 SMN1 GFP, tdTomato CAG Spinal muscular atrophy Chaolin Zhang 216225...
  20. Validated gRNA Sequences

    Type
    Collection
    ...ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N...
Showing: 1 - 20 of 21 results