Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 41 - 46 of 46 results
  1. The Pleiades Promoter Project

    Type
    Collection
    ...MiniPromoters MiniPromoter Source Gene Construct Reporter Negative Control N/A pEMS1312 cre N/A pEMS1301...
  2. Brain Initiative Collection

    Type
    Collection
    ...plasmid encoding for Archon1 fluorescent voltage reporter, Cre-dependent expression Edward Boyden 108912...
  3. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...
Showing: 41 - 46 of 46 results