Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 25 results for: plasmid for e coli

Showing: 1 - 20 of 25 results

  1. Open Enzyme Collection

    Type
    Collection
    ...pOpen-Endonuclease IV E. coli E. coli Endonuclease IV 165561 pOpen-Endonuclease VIII E. coli E. coli Endonuclease...Endonuclease VIII 165571 pOpen-Exonuclease III E. coli E. coli Exonuclease III 165559 pOpen-T5gene12/13 T5 Exonuclease...BioBricks Foundation Plasmids Drew Endy Lab Plasmids Jennifer Molloy Lab Plasmids Golden Gate cloning ... pOpen-T4gene30 T4-DNA Ligase 165564 pOpen-ECOligA E. coli DNA Ligase 165569 pOpen-Tthlig Tth DNA Ligase...expression vector of their choice and transforming into E. coli bacteria. This can help reduce lab costs and overcome...vector of their choice and then transform into E. coli for expression and purification ( pET28a-LIC or...) . Open Enzymes are also compatible with the E. coli Protein Expression Toolkit (Link opens in a new...

  2. Microbiology Resources

    Type
    Collection
    ... Plasmid Collections Microbiology Plasmids Microbiology Plasmids and Resources Addgene...for providing individual plasmids is a bacterial stab (of a laboratory E. coli strain). Addgene continues...and biosafety regulations. Looking for E. coli or yeast plasmids? Addgene has a wide variety of tools for...protein expression in E. coli, B. subtilis and P. pastoris - Gomis-Rüth Lab pOSIP plasmid kit : Integration... Lindquist Lab Synthetic Biology BIOFAB plasmid set : E. coli gene expression - Endy Lab CIDAR MoClo Parts...bacteria. CRISPathBrick Multiplex Plasmid : CRISPR expression in E. coli - Koffas Lab Additional Addgene...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...

  3. Genetic Code Expansion

    Type
    Collection
    ...tyrosyl-tRNA synthetase E. coli pBof Mammalian TAG Huiwang Ai 68292 SepOTSλ SepRS9 E. coli Sep Bacterial TAG...synthetase E. coli Mammalian TAG Simon Elsaesser 140019 pAS_4xEcoLeuT(CUA)_AnapRS AnapRS E. coli 3-(6-acetylnaphthalen...leucyl-tRNA-synthetase E. coli photocaged cysteine Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli...Generally, you will need two plasmids, as depicted in the figure below: A plasmid expressing the tRNA and ...Research Center . Browse Synthetase Plasmids The table below highlights plasmids that contain aminoacyl tRNA ...Abhishek Chatterjee Browse Target Plasmids The table below highlights plasmids that contain genes with modified...express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You should ...

  4. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...33,170 Bikard Lab E. coli Genome-wide Inhibition Library v1 115927 Inhibition E. coli Bikard N/A 19 92,...Bikard Lab EcoWG1: E. coli Genome-wide Inhibition Library v2 131625 Inhibition E. coli Bikard N/A ∼5 21,... Zhang E. coli Genome-wide Inhibition Library 113134 — 113138 113146, 113147 Inhibition E. coli Chong ...Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 ...76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 ...GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid) Knockout Human Doench and Root 3rd... 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 ...

  5. Bacterial Expression Systems

    Type
    Collection
    ... protein expression Plasmids 101: Common Lab E. coli Strains Why Bacteria? E. coli are commonly used to...Reporter Plasmids You may also like… Plasmids 101 Addgene's Molecular Biology Guides Plasmids 101: E. coli...interest. Plasmid ID Promoter Inducer(s) PI Purpose Murray Lab pBEST plasmids Various Plasmids pBAD, OR2...replicate plasmids of all types, but beyond that, researchers also use bacteria like E. coli and their...a protein of interest in E. coli , B. subtilis and P. pastoris . All plasmids use the same restriction...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Purification Controlled Expression Reporter Plasmids Reporter Plasmids Tagging and Visualization Purification...

  6. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...SepOTSγ Plasmid 68285 SepOTSδ Plasmid 68286 SepOTSϵ Plasmid 68287 SepOTSζ Plasmid 68288 SepOTSη Plasmid...SepOTSθ Plasmid 68290 SepOTSι Plasmid 68291 SepOTSκ Plasmid 52054 SepOTSµ ( aka. B40 OTS) Plasmid 68294 ...68294 SepOTSν Plasmid 68295 GFP E17TAG Plasmid 68296 GFP S2TAG Plasmid 68297 GFP Q157TAG Plasmid 68298 GFP...Amp) Plasmid 68300 MBP-MEK1 Plasmid 68301 MBP-MEK1 S218TAG Plasmid 68302 MBP-MEK1 S222TAG Plasmid 68305... 68306 C321.ΔA.Δserb.Amp S Plasmid 68292 SepOTSλ Plasmid 68307 SupD Plasmid 34623 SepOTSα SepRS/EF-Sep...pKD-SepRS-EFSep) Plasmid 34624 SepOTSα tRNA-Sep ( aka. pCAT112TAG-SepT) Plasmid 68283 SepOTSβ Plasmid 68284 SepOTSγ...( 188537 ) is a ROP minus plasmid and is not compatible with other plasmids containing high copy ColE1...

  7. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9 BsaI E. coli, S. ...efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter...with a wide variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Validated In...Ampicillin none, need Cas9 plasmid Qi Do you have suggestions for other plasmids that should be added to ...to this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...

  8. Tetracycline Inducible Expression

    Type
    Collection
    ...has high copy E. coli origin None Either Ralser 64238 pTet-IRES-EGFP Lentiviral plasmid for inducible ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Browse Tetracycline Plasmids Tet-regulated Lentiviral RNAi Vectors Curated Plasmid Collections Background...interest tTA expression plasmid Components for a tetracycline on system are: Plasmid containing a tetracycline-dependent...generation lentiviral plasmid for inducible expression of shRNA; neomycin selection; plasmid 21915 has puromycin...eukaryotes. At the time, bacterial systems from E. coli presented the best candidates for inducible expression... Plasmid Collections Tetracycline (Tet) Inducible Expression...

  9. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...posts , or find CRISPR plasmids for your research. Addgene has CRISPR plasmids for the following models...Repeat) sequences were initially discovered in the E. coli genome in 1987, but their function as a safeguard...Mammalian systems (Human, mouse, and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila... in the field, and enabling access to multiple plasmids used for various platform applications. For more...alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J Bacteriol...Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. 2012. A programmable dual-RNA-guided DNA endonuclease... Saunders SJ, Barrangou R, Brouns SJ, Charpentier E, Haft DH, Horvath P, Moineau S, Mojica FJ, Terns RM...

  10. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...PCR cloning kit) into a plasmid vector. Transform the plasmid into DH5α E. coli cells and plate onto LB...usage of the pSpCas9(BB) plasmid (pX330) (Addgene plasmid ID 42230). This plasmid allows for the simultaneous...Exp . 2007. PubMed . Transformation of plasmid DNA into E. coli using the heat shock method. ...utilized, such as pX458 (Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), which include GFP ...reaction (see step 3.2 ). Transform 10 μl of DH5α E. coli cells with 1 μl of reaction (from 3.2.1 - 3.2.2...Mammalian Cell Lines Other Addgene Resources CRISPR Plasmids CRISPR Guide Addgene Blog Posts Addgene is proud...multiple sgRNAs may be expressed from a single plasmid. Add “CACC” before the 20-mer guide sequence and...

  11. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...CRISPR Plasmids: Base Edit Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit... the tables below for CRISPR base editing plasmids. Plasmids are available for expression in mammalian...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert...Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert...CRISPR plasmids for precisely editing DNA bases without inducing a DNA break. CRISPR...created by directed evolution of the Escherichia coli TadA, a tRNA adenine deaminase. Like cytosine base...

  12. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... Plasmid Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Empty backbones...Collection NLS Nuclear localization dCas9 plasmid - dCas9 expression plasmid without effector fusions; 3X Flag... of plasmids for packaging and expression, see our dedicated Adeno-associated Virus (AAV) Plasmids page...collection of plasmids for packaging and expression, see our dedicated Lentiviral Plasmids page Retroviral...contains AdEasy®-1 plasmid View our Adenovirus Plasmids page for more information Genome...of your cells will take up your plasmid. Thus, many plasmids have markers on them so that you...

  13. Viral Production

    Type
    Collection
    ...the transfer plasmid, a plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral...coli . In addition, plasmids are typically prepared using endotoxin-free plasmid purification kits. Resources...all plasmids used for viral production are propagated in the endA -mutated NEB Stable strain of E. coli...contamination is minimized by using an endotoxin-free plasmid purification protocol. To minimize the immunogenic...off-line and discarded. Confirmation of Transfer Plasmid Addgene uses a rigorous barcode matching system...experiment using our virus protocols . Browse our plasmid collection of popular lentiviral vectors ....

  14. CRISPR Guide

    Type
    Collection
    ...36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang, H. H., & Sternberg, S. H... R., Hanna, R. E., Hegde, M., Donovan, K. F., Strand, C., Sullender, M. E., Vaimberg, E. W., Goodale, ... the DNA and replaces it with another base. In E. coli , this strategy yields C to A base edits, whereas...harnessed for antiviral mechanisms in bacteria ( E. coli ). Like the other Cas enzymes, the Cascade-Cas3...edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed by the.... PMID: 26735016 Lee, J. K., Jeong, E., Lee, J., Jung, M., Shin, E., Kim, Y., Lee, K., Jung, I., Kim, ..., K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-Guided Human...

  15. CRISPR References and Information

    Type
    Collection
    ...Addgene CRISPR Resources CRISPR Plasmids Addgene's collection of CRISPR plasmids. CRISPR Guide Addgene's guide...and activation). Genome support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm (...guide to using CRISPR plasmids in your lab, from knockouts to pooled library screening. CRISPR eBook Addgene's...barcoding. CRISPR Kits Addgene's collection of CRISPR plasmid kits. CRISPR Software Sanger Indel Analysis ICE... Feng Zhang Lab . Protocols Lab(s) Description Plasmids in protocol Download protocol Addgene CRISPR pooled...gRNA design and cloning for Cas9 orthologs Cas9 plasmids PDF, 107 KB Chen and Wente Zebrafish: gRNA cloning... (Cre recombinase) PDF, 105 KB Jaenisch CRISPR plasmid summary for transcriptional activation dCas9 activators...

  16. COVID-19 Resources

    Type
    Collection
    ... distribute SARS-CoV-2 plasmids. The collection contains: Plasmids for E. coli and Yeast expression Spike...nucleocapsid protein (Brian Geiss). Plasmids SARS-CoV-2 Plasmids Many plasmids containing SARS-CoV-2 sequences...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Addgene will maintain this plasmid collection page, which highlights plasmids available that may be useful...SARS-CoV-2 nucleocapsid protein. SARS-CoV-2 Plasmids : Plasmids that are available or coming soon containing...containing SARS-CoV-2 sequences. SARS-CoV Plasmids : Plasmids that are available containing SARS-CoV (SARS ...to popular envelope and packaging plasmids. Ginkgo Bioworks Plasmid Collection - Addgene has partnered...

  17. Validated gRNA Sequences

    Type
    Collection
    ...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...Datatable Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes 26627737...

  18. Luciferase Plasmid Collection

    Type
    Collection
    ...Collections Luciferase Plasmids Luciferase Plasmid Collection You may also like... Fluorescent Proteins Blog...luciferase. Plasmids are Gateway cloning compatible. Learn more about DULIP in our 27 Hot Plasmids from 2016...luciferase reporter. These plasmids improve over the original STARR-seq plasmids by using the bacterial ORI...otherwise noted, these plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s...luciferase expression plasmids; these are noted with the viral service icon . ID Plasmid Luciferase Type Promoter.... ID Plasmid Description Gene/Insert PI Return to Top Do you have suggestions for other plasmids that ...luciferase gene allow for increased copy number in E. coli and expression of luciferase in the cytoplasm of...

  19. Cre-lox system

    Type
    Collection
    ... Plasmid Collections Cre-lox Plasmids Cre-lox Plasmids Additional...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Cre-lox Plasmids Addgene's Blog: Cre-lox Addgene's Blog: FLEx Vectors Cre-containing Plasmids loxP Constructs...viral preparations of plasmids that are currently in our repository. ID Plasmid Description Promoter Expression...loxP plasmids, reporter genes indicate which cells have undergone Cre recombination. These plasmids can...intron, preventing Cre expression when cloning in E. coli . This alteration enables the generation of a single...construct (unmodified Cre will cause recombination in E. coli , deleting the floxed portion of a construct during...

  20. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... on the plasmid. gRNA plasmids that do not co-express a Cas protein require a separate plasmid that does...gRNA Vectors CRISPR Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids By Function Genome ... these independent gRNA plasmids can be paired with a wide variety of plasmids and therefore are not limited.... Whether the plasmid contains Cas9 and if so, which function of Cas9. We have plasmids with Cas9 that...none, need plasmid 65775 N. meningitidis Joung VVT1 65779 Mammalian BsmBI none, need plasmid 65776 S. aureus...expression of Csy4 (eg Plasmid 53369 ). Joung pX333 Mammalian Single all-in-one plasmid for tandem expression...types of plasmids available for use in this Golden Gate and Gateway based assembly method: plasmids for assembly...
Showing: 1 - 20 of 25 results