Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 26 results for: plasmid for e coli

Showing: 1 - 20 of 26 results

  1. Bacterial Expression Systems

    Type
    Collection
    ...Photobiology: Optogenetics for E. coli Return to top Reporter Plasmids Reporter plasmids can be used to detect ... modular cloning (MoClo) for use in E. coli . Addgene Blog E. Coli Strains for Protein Expression Protein...selection of plasmids and tags for protein purification. The pTD Plasmid Series contains plasmids suitable...bacterial strains such as E. coli BL21(DE3) are used as biofactories to express plasmids and produce proteins...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Expansion Collection Microbiology Plasmids Collection Synthetic Biology Plasmids Collection Empty Backbones ...under the microscope. The plasmids in this collection are clone-in ready plasmids that contain fluorescent...

  2. Open Enzyme Collection

    Type
    Collection
    ...pOpen-Endonuclease IV E. coli E. coli Endonuclease IV 165561 pOpen-Endonuclease VIII E. coli E. coli Endonuclease...Synthetic Biology Plasmids BIOFAB Plasmid Set Drew Endy Lab Plasmids Jennifer Molloy Lab Plasmids Blog: Golden...Endonuclease VIII 165571 pOpen-Exonuclease III E. coli E. coli Exonuclease III 165559 pOpen-T5gene12/13 T5 Exonuclease... pOpen-T4gene30 T4-DNA Ligase 165564 pOpen-ECOligA E. coli DNA Ligase 165569 pOpen-Tthlig Tth DNA Ligase...expression vector of their choice and transforming into E. coli bacteria. This can help reduce lab costs and overcome...vector of their choice and then transform into E. coli for expression and purification ( pET28a-LIC or...) . Open Enzymes are also compatible with the E. coli Protein Expression Toolkit (Link opens in a new...

  3. Microbiology Resources

    Type
    Collection
    ... Plasmid Collections Microbiology Plasmids Microbiology Plasmids and Resources Addgene...for providing individual plasmids is a bacterial stab (of a laboratory E. coli strain). Addgene continues...and biosafety regulations. Looking for E. coli or yeast plasmids? Addgene has a wide variety of tools for...protein expression in E. coli, B. subtilis and P. pastoris - Gomis-Rüth Lab pOSIP plasmid kit : Integration... Lindquist Lab Synthetic Biology BIOFAB plasmid set : E. coli gene expression - Endy Lab CIDAR MoClo Parts...bacteria. CRISPathBrick Multiplex Plasmid : CRISPR expression in E. coli - Koffas Lab Additional Addgene...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...

  4. Genetic Code Expansion

    Type
    Collection
    ...tyrosyl-tRNA synthetase E. coli pBof Mammalian TAG Huiwang Ai 68292 SepOTSλ SepRS9 E. coli Sep Bacterial TAG...synthetase E. coli Mammalian TAG Simon Elsaesser 140019 pAS_4xEcoLeuT(CUA)_AnapRS AnapRS E. coli 3-(6-acetylnaphthalen...leucyl-tRNA-synthetase E. coli photocaged cysteine Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli...Generally, you will need two plasmids, as depicted in the figure below: A plasmid expressing the tRNA and ...Research Center . Browse Synthetase Plasmids The table below highlights plasmids that contain aminoacyl tRNA ...Abhishek Chatterjee Browse Target Plasmids The table below highlights plasmids that contain genes with modified...express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You should ...

  5. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...33,170 Bikard Lab E. coli Genome-wide Inhibition Library v1 115927 Inhibition E. coli Bikard N/A 19 92,...Bikard Lab EcoWG1: E. coli Genome-wide Inhibition Library v2 131625 Inhibition E. coli Bikard N/A ∼5 21,... Zhang E. coli Genome-wide Inhibition Library 113134 — 113138 113146, 113147 Inhibition E. coli Chong ...Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 ...76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 ...GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid) Knockout Human Doench and Root 3rd... 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 ...

  6. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...SepOTSλ Plasmid 68291 SepOTSκ Plasmid 68290 SepOTSι Plasmid 68289 SepOTSθ Plasmid 68288 SepOTSη Plasmid 68287...S218TAG Plasmid 68300 MBP-MEK1 Plasmid 68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297...GFP Q157TAG Plasmid 68296 GFP S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ...68287 SepOTSζ Plasmid 68286 SepOTSϵ Plasmid 68285 SepOTSδ Plasmid 68284 SepOTSγ Plasmid 68283 SepOTSβ Plasmid....ΔA.Δserb.Amp Plasmid 68305 Beta lactamase S68TAG Plasmid 68302 MBP-MEK1 S222TAG Plasmid 68301 MBP-MEK1...SepOTSλ (Plasmid #68292) . An important technical note: pSerOTS-C1* (V70) is a ROP minus plasmid and is ... other plasmids containing high copy ColE1/PUC-like origins. Therefore, when choosing plasmids to express...

  7. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9 BsaI E. coli, S. ...efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter...with a wide variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Validated In...Ampicillin none, need Cas9 plasmid Qi Do you have suggestions for other plasmids that should be added to ...to this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...

  8. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...posts , or find CRISPR plasmids for your research. Addgene has CRISPR plasmids for the following models...Repeat) sequences were initially discovered in the E. coli genome in 1987, but their function as a safeguard...Mammalian systems (Human, mouse, and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila... in the field, and enabling access to multiple plasmids used for various platform applications. For more...alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J Bacteriol...Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. 2012. A programmable dual-RNA-guided DNA endonuclease... Saunders SJ, Barrangou R, Brouns SJ, Charpentier E, Haft DH, Horvath P, Moineau S, Mojica FJ, Terns RM...

  9. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...PCR cloning kit) into a plasmid vector. Transform the plasmid into DH5α E. coli cells and plate onto LB...usage of the pSpCas9(BB) plasmid (pX330) (Addgene plasmid ID 42230). This plasmid allows for the simultaneous...Exp . 2007. PubMed . Transformation of plasmid DNA into E. coli using the heat shock method. ...utilized, such as pX458 (Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), which include GFP ...reaction (see step 3.2 ). Transform 10 μl of DH5α E. coli cells with 1 μl of reaction (from 3.2.1 - 3.2.2...Mammalian Cell Lines Other Addgene Resources CRISPR Plasmids CRISPR Guide Addgene Blog Posts Addgene is proud...multiple sgRNAs may be expressed from a single plasmid. Add “CACC” before the 20-mer guide sequence and...

  10. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...CRISPR Plasmids: Base Edit Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit... the tables below for CRISPR base editing plasmids. Plasmids are available for expression in mammalian...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert...Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert...CRISPR plasmids for precisely editing DNA bases without inducing a DNA break. CRISPR...created by directed evolution of the Escherichia coli TadA, a tRNA adenine deaminase. Like cytosine base...

  11. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... Plasmid Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Empty backbones...Collection NLS Nuclear localization dCas9 plasmid - dCas9 expression plasmid without effector fusions; 3X Flag... of plasmids for packaging and expression, see our dedicated Adeno-associated Virus (AAV) Plasmids page...collection of plasmids for packaging and expression, see our dedicated Lentiviral Plasmids page Retroviral...contains AdEasy®-1 plasmid View our Adenovirus Plasmids page for more information Genome...of your cells will take up your plasmid. Thus, many plasmids have markers on them so that you...

  12. Promega Plasmid Collection

    Type
    Collection
    ...Promega Plasmid Collection Promega Plasmid Collection Ordering & Availability All Plasmids Plasmid Technology...our help center . Plasmid Collection Browse, sort, or search the table below of plasmids in the collection...HaloTag", "BiT", or other terms. ID Plasmid Description Industry Plasmid Technology Overview This collection...Browse Addgene's Luciferase Plasmid Collection Explore other Promega plasmids available at Addgene Find ...for various protein expression systems including E. coli , mammalian cells, and cell-free systems. HiBiT...operational complexity. This unique collection contains plasmids developed by Promega scientists and designed to...HaloTag, SmBiT, and LgBiT. Ordering & Availability Plasmids from the Promega collection are available in two...

  13. Viral Production

    Type
    Collection
    ...the transfer plasmid, a plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral...coli . In addition, plasmids are typically prepared using endotoxin-free plasmid purification kits. Resources...all plasmids used for viral production are propagated in the endA -mutated NEB Stable strain of E. coli...contamination is minimized by using an endotoxin-free plasmid purification protocol. To minimize the immunogenic...off-line and discarded. Confirmation of Transfer Plasmid Addgene uses a rigorous barcode matching system...experiment using our virus protocols . Browse our plasmid collection of popular lentiviral vectors ....

  14. CRISPR Guide

    Type
    Collection
    ...36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang, H. H., & Sternberg, S. H... R., Hanna, R. E., Hegde, M., Donovan, K. F., Strand, C., Sullender, M. E., Vaimberg, E. W., Goodale, ... the DNA and replaces it with another base. In E. coli , this strategy yields C to A base edits, whereas...harnessed for antiviral mechanisms in bacteria ( E. coli ). Like the other Cas enzymes, the Cascade-Cas3...edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed by the.... PMID: 26735016 Lee, J. K., Jeong, E., Lee, J., Jung, M., Shin, E., Kim, Y., Lee, K., Jung, I., Kim, ..., K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-Guided Human...

  15. CRISPR References and Information

    Type
    Collection
    ...Addgene CRISPR Resources CRISPR Plasmids Addgene's collection of CRISPR plasmids. CRISPR Guide Addgene's guide...and activation). Genome support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm (...guide to using CRISPR plasmids in your lab, from knockouts to pooled library screening. CRISPR eBook Addgene's...barcoding. CRISPR Kits Addgene's collection of CRISPR plasmid kits. CRISPR Software Sanger Indel Analysis ICE... Feng Zhang Lab . Protocols Lab(s) Description Plasmids in protocol Download protocol Addgene CRISPR pooled...gRNA design and cloning for Cas9 orthologs Cas9 plasmids PDF, 107 KB Chen and Wente Zebrafish: gRNA cloning... (Cre recombinase) PDF, 105 KB Jaenisch CRISPR plasmid summary for transcriptional activation dCas9 activators...

  16. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Site-Specific Recombinases Cre Plasmids Dre Plasmids Flp Plasmids Other Recombinase Plasmids Recombinase-Dependent...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Fluorescent Biosensors Chemogenetics Plasmid Collection Optogenetics Plasmid Collection Monosynaptic Neuronal... vectors. Highlighted Plasmids Browse the tables below to find popular plasmids expressing your favorite...tamoxifen”, or “light”): Cre Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional... with GFP Plasmids 101: FLEx Vectors Optimizing AAV DIO and FLEx Vector Expression Plasmids 101: Knockout... Flp Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources ...

  17. COVID-19 Resources

    Type
    Collection
    ... distribute SARS-CoV-2 plasmids. The collection contains: Plasmids for E. coli and Yeast expression Spike...nucleocapsid protein (Brian Geiss). Plasmids SARS-CoV-2 Plasmids Many plasmids containing SARS-CoV-2 sequences...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Addgene will maintain this plasmid collection page, which highlights plasmids available that may be useful...SARS-CoV-2 nucleocapsid protein. SARS-CoV-2 Plasmids : Plasmids that are available or coming soon containing...containing SARS-CoV-2 sequences. SARS-CoV Plasmids : Plasmids that are available containing SARS-CoV (SARS ...to popular envelope and packaging plasmids. Ginkgo Bioworks Plasmid Collection - Addgene has partnered...

  18. Validated gRNA Sequences

    Type
    Collection
    ...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...Datatable Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes 26627737...

  19. Tetracycline Inducible Expression

    Type
    Collection
    ...Mammalian shRNA Plasmids Collection Cre-lox Plasmids Collection Stem Cell Research Plasmids Collection Tetracycline...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help.... ID Plasmid Description Transactivator Promoter PI 21915 Tet-pLKO-puro Lentiviral Tet-On plasmid for ...with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...search our collection for all dox-regulated plasmids . ID Plasmid Description PI 63800 PB-TRE-dCas9-VPR Tet-inducible...have adapted an antibiotic resistance operon from E. coli : the tetracycline repressor protein (TetR) and...expression and find plasmids for your experiments using tet- or dox-inducible systems. Plasmid...

  20. Luciferase Plasmid Collection

    Type
    Collection
    ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Luciferase Plasmids Luciferase Plasmid Collection Empty Backbones Expression Constructs Reporter Constructs...otherwise noted, these plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s...preparations of select luciferase expression plasmids. ID Plasmid Luciferase Type Promoter Description PI ...luciferase gene allow for increased copy number in E. coli and expression of luciferase in the cytoplasm of...of luciferase plasmids for gene expression assays and bioluminescent reporters. Plasmid... Plasmid Collections Luciferase...
Showing: 1 - 20 of 26 results