Skip to main content

We narrowed to 5 results for: 1-Oct

Showing: 1 - 5 of 5 results
  1. Promoters

    Type
    Guide
    ... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate... Plasmids 101 topics Content last reviewed: 22 October 2025...
  2. Optogenetics Guide

    Type
    Guide
    ...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L...Red-light drivable channel from Chlamydomonas noctigama . ChrimsonR carries K176R mutation. 590 PsChR2...
  3. Sequencing Primers

    Type
    Guide
    ...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...Xpress epitope Forward Content last reviewed: 22 October 2025...
  4. Molecular Biology Reference

    Type
    Guide
    ... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...blog Addgene Protocols Content last reviewed: 22 October 2025...
  5. Molecular Cloning Techniques

    Type
    Guide
    ...more in our Restriction Cloning blog post . Figure 1: Restriction enzyme cloning of your gene of interest...Plasmids cloning topics Content last reviewed: 22 October 2025...
Showing: 1 - 5 of 5 results