Skip to main content
Addgene
Showing: 1 - 17 of 17 results

  1. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...marking active neuron populations. Nat Commun. 2018 Oct 25;9(1):4440. Eric Schreiter Calcium AAV expression ...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...interneurons across vertebrate species. Nat Neurosci. 2016 Oct 31. Gordon Fishell Calcium GCaMP5 genetically encoded...indicator for neural activity imaging. J Neurosci. 2012 Oct 3;32(40):13819-40. Baljit Khakh , Douglas Kim , Loren...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET... Secretion of Pancreatic Islets. Anal Chem. 2019 Oct 1;91(19):12212-12219. Huiwang Ai Zinc GZnP2 Cytosolic... Encoded Fluorescent Biosensor. Cell Metab. 2011 Oct 5;14(4):545-54. Gary Yellen NADH/NAD+ Peredox fluorescent...

  2. p53 Pathway

    Type
    Collection
    ...-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific angiogenesis inhibitor 1 Bax BCL2-associated...inhibitor type 1), member 1 PERP TP53 apoptosis effector PIDD p53-induced death domain protein 1 PIGs Etoposide... Name 14-3-3-σ Stratifin Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine kinase...kinase 4 or 6 CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2...receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell surface death receptor ...SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2...p53 field. Brosh R, Rotter V. Nat Rev Cancer. 2009 Oct;9(10):701-13. PubMed PMID: 19693097 . The expanding...

  3. Zhang Lab CRISPR Page

    Type
    Collection
    ...Heidenreich 1, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol . 2015 Jan;33(1):102-6....2013.08.021. Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using...2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. PubMed . Return to SpCas9 plasmids GeCKO Library...-6. doi: 10.1038/nbt.3055. Epub 2014 Oct 19. PubMed . In vivo genome editing using Staphylococcus aureus... Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014....SpCas9 alone without sgRNA. Full references are below. 1. SpCas9 (or SpCas9n, D10A nickase) + single guide ...screens. The libraries are available in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together...

  4. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Other citations include...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Rosario, et al. 2016. ...for any application TMN200 (200 mM sodium chloride, 1 mM magnesium chloride, 20 mM Tris at pH 8.0) Suitable...adeno-associated viral vector. Hum Gene Ther Methods . Feb;25(1):72-82. PMID: 24191859 Ye, et al. 2015. Safety and...

  5. Neurodegeneration Research Collection

    Type
    Collection
    ...between Rab12 and LRRK2 . Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries...target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. Target neural oxytocin receptors using an AAV-CRISPR...dopaminergic activity in vivo. Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation...one of three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of...

  6. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...Saccharomyces cerevisiae. Microb Cell Fact. 2013 Oct 25;12:96. doi: 10.1186/1475-2859-12-96. PubMed 24161108...proteins in budding yeast. Sci Rep. 2019 Feb 19;9(1):2234. doi: 10.1038/s41598-019-38913-z. PubMed 30783202...

  7. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Rafelski SM, Gunawardane RN. Mol Biol Cell. 2017 Oct 15;28(21):2854-2874. doi: 10.1091/mbc.E17-03-0209...Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP ...TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP ...Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin... HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin...

  8. Jaenisch Lab CRISPR Plasmids

    Type
    Collection
    ...Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Oct;23(10):1163-71. doi: 10.1038/cr.2013.122. Epub 2013...plasmids can be ordered via the links below: Table 1. dCas9 Activators sgRNA Dual Expression ID Plasmid...

  9. Antibody Plasmid Collection

    Type
    Collection
    ...Tomlinson I+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...immunostaining. Biochem Biophys Res Commun. 2015 Jan 2;456(1):527-33. Gavin Wright pET-30-based vector dedicated...

  10. Tetracycline Inducible Expression

    Type
    Collection
    ...Pfleiderer K, Hillen W, Berens C. Biotechniques . 2004 Oct;37(4):546, 548, 550. PubMed . Optimization of the..., Klaver B, Berkhout B, Das AT. Gene Ther . 2006 Oct;13(19):1382-90. PubMed . Improved Tet-responsive ...Element On or off PI 26429 pLenti CMV rtTA3 Blast (w756-1) Lentiviral reverse tetracycline-controlled transactivator...

  11. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...gRNA-hIRF-1 #12 Expresses a guide RNA (gRNA) to target human IRF-1 promoter 61080 gRNA-hIRF-1 #12/pSIR ..._dCas9-2xAM_hIRF-1 Lentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoter. 98041 Sa-dCas9...interest. 98134 hIRF-1 gRNA #409 (Sa) Expresses a guide RNA (gRNA) to target human IRF-1 promoter for the ...system. 105283 hIRF-1 gRNA #351 (Sa) Expresses a guide RNA (gRNA) to target human IRF-1 promoter for the ...Yuno M, Suzuki Y, Sugano S, Fujii H. DNA Res. 2017 Oct 1;24(5):537-548. doi: 10.1093/dnares/dsx023. PubMed...LexA are subjected to affinity purification (Fig. 1). In enChIP, specific genomic regions are tagged with...plasmids or browse the Fujii Lab web page . Figure 1: iChIP general scheme Figure 2: enChIP general scheme...

  12. Plasmids for Stem Cell Research

    Type
    Collection
    ... 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from...106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible lentiviral expression of mouse Oct4, Sox2...Developmental Potential of iPSCs. Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. Schöler You can also...MicroRNA-Dependent Direct Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral...cell reprogramming. Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating...transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory Neurons Lentiviral...peripheral sensory neurons. Nat Neurosci. 2015 Jan;18(1):25-35. Baldwin Fibroblasts iTSCs Lentiviral Mouse...

  13. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...library as GST-fusion peptides (“mode #1” expression). The mode #1 phosphosite library ( 111704 ) is available...Söll D, Isaacs FJ, Rinehart J. FEBS Lett . 2012. Oct 19;586(20):3716-22. PubMed (Link opens in a new window...standards for quantitative assessments. The mode #1 phosphosite library can be generated with either phosphoserine...available from Addgene. Screening kinases. The mode #1 phosphosite library can also be synthesized using ...pSerOTS-C1* (V70) Pooled Library 188526 iSPI_pSer_Subpool#1 Pooled Library 188527 iSPI_pSer_Subpool#2 Pooled Library...split mCherry 14-3-3β Pooled Library 111704 Mode #1 Library Pooled Library 111705 Mode #2 Library (14-...partial UAG codon reassignment and release factor 1 deletion. Heinemann IU, Rovner AJ, Aerni HR, Rogulina...

  14. Validated gRNA Sequences

    Type
    Collection
    ...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes...

  15. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha...

  16. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Farren Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73547 pEvol-pAzFRS.1.t1 pAzFRS.1.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...7FTrp) Bacterial TAG Thomas Huber 207639 pEVOL-NBK-1 PylRS M. mazei Pyrrolysine Bacterial Cole DeForest...and tyrU gene replaced by GentR) and release factor 1. Expresses archaeal MjTyrRS/tRNA pair instead. For...122650 Mm-PylRS-AF/Pyl-tRNACUA PylRS M. mazei trans-cyclooct- 2-ene-lysine (TCOK) Mammalian TAG Howard Hang...

  17. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mEGFP 488 507 34 6 Monomer (A206K) pmEGFP-1 - Mammalian Expression mEGFP-N1 - Mammalian Expression...TurboRFP-pBAD - Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...-pBAD - Bacterial Expression mRFP1 584 607 13 4.5 1 hr Monomer pcDNA3-mRFP - Mammalian Expression pMXs-mRFP1... of Biomedical Optics, Feburary 2005, Vol. 10 No. 1, p. 14003 Chu et al. : Nature Methods, May 2014 Vol...pp. 7913–7923 Hoi et al. : Chemistry & Biology, October 2013, Vol. 20 No. 10, pp.1296-304 Kogure et al....
Showing: 1 - 17 of 17 results