We narrowed to 7 results for: CHL

...channelrhodopsin, used to silence neuronal activity 488 iChloC Chloride-conducting channel, CrChR2 with mutations E90R...channelrhodopsins were discovered in the green algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited... ChRs from other species include CoChR (from Chloromonas oogama ) and SdChR (from Scherffelia dubia )....identified in other species. By acting as light-gated chloride channels, these variants result in the hyperpolarization...Halorhodopsins are light-gated, inward-directed chloride pumps isolated from halobacteria. Wild-type halorhodopsin...for your experiments. Channelrhodopsins from Chlamydomonas reinhardtii Name Description Peak excitation...Widely used light-gated cation channel from Chlamydomonas reinhardtii (CrChR2) 470 ChR2/H134R Widely used...

...including CRISPR/Cas9 components. MoChlo: Modular Cloning Chloroplast Toolbox Plant Expression Scott Lenaghan...Lenaghan 122 plasmids with chloroplast-specific genetic modules, including destination vectors specific...

.... Other molecules, including Compound 21, deschloroclozapine (DCZ), perlapine, and olanzapine, have all...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Kumata, K., Seki, C., … Minamimoto, T. (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...

...alternatives Abudayyeh, O. O., Gootenberg, J. S., Essletzbichler, P., Han, S., Joung, J., Belanto, J. J., Verdine...Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., Verdine, V., Donghia..., O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., Van Der Oost, ...

..., M., Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF...science.272.5259.263 PMID: 8602510 Schambach, A., Zychlinski, D., Ehrnstroem, B., & Baum, C. (2013). Biosafety...

...Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...

...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in Ethanol) 25 µg/mL Hygromycin...