We narrowed to 7 results for: CHL

... mutations 540 Channelrhodopsins: chloride channels iChloC Chloride-conducting channel, CrChR2 with mutations...species include: CsChR (from Chloromonas subdivisa ), CoChR (from Chloromonas oogama ), and SdChR (from ...Examples: iChloC, SwiChRca, Phobos, Aurora Halorhodopsins Halorhodopsins are light-gated inward chloride pumps...channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from Chlamydomonas reinhardtii...Channelrhodopsin from Chloromonas oogama CsChR Channelrhodopsin from Chloromonas subdivisa CheRiff Channelrhodopsin...channelrhodopsins were discovered in the green algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited...identified in other species. By acting as light-gated chloride channels, these variants result in the hyperpolarization...

...including CRISPR/Cas9 components. MoChlo: Modular Cloning Chloroplast Toolbox Plant Expression Scott Lenaghan...Lenaghan 122 plasmids with chloroplast-specific genetic modules, including destination vectors specific...

... alternative DREADD ligands. Compound 21, deschloroclozapine (DCZ), perlapine, and olanzapine have all...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Kumata, K., Seki, C., … Minamimoto, T. (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...

...alternatives Abudayyeh, O. O., Gootenberg, J. S., Essletzbichler, P., Han, S., Joung, J., Belanto, J. J., Verdine...Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., Verdine, V., Donghia..., O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., Van Der Oost, ...

..., M., Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF...science.272.5259.263 PMID: 8602510 Schambach, A., Zychlinski, D., Ehrnstroem, B., & Baum, C. (2013). Biosafety...

...Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...

...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in Ethanol) 25 µg/mL Hygromycin...