Skip to main content
Addgene

We narrowed to 6 results for: CHL

Showing: 1 - 6 of 6 results
  1. Optogenetics Guide

    Type
    Guide
    ... mutations 540 Channelrhodopsins: chloride channels iChloC Chloride-conducting channel, CrChR2 with mutations...species include: CsChR (from Chloromonas subdivisa ), CoChR (from Chloromonas oogama ), and SdChR (from ...channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from Chlamydomonas reinhardtii...Channelrhodopsin from Chloromonas oogama CsChR Channelrhodopsin from Chloromonas subdivisa CheRiff Channelrhodopsin...channelrhodopsins were discovered in the green algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited...identified in other species - by acting as light-gated chloride channels, these variants result in the hyperpolarization...include: Increased photocurrent amplitude Examples: iChloC, SwiChRca, Phobos, Aurora Browse Channelrhodospin...
  2. Chemogenetics Guide

    Type
    Guide
    ... alternative DREADD ligands. Compound 21, Deschloroclozapine (DCZ), Perlapine, and Olanzapine have all...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...
  3. CRISPR Guide

    Type
    Guide
    ...alternatives Abudayyeh, O. O., Gootenberg, J. S., Essletzbichler, P., Han, S., Joung, J., Belanto, J. J., Verdine...Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., Verdine, V., Donghia..., O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., Van Der Oost, ...
  4. Lentiviral Vector Guide

    Type
    Guide
    ..., M., Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF...science.272.5259.263 PMID: 8602510 Schambach, A., Zychlinski, D., Ehrnstroem, B., & Baum, C. (2013). Biosafety...
  5. Sequencing Primers

    Type
    Guide
    ...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...
  6. Molecular Biology Reference

    Type
    Guide
    ...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Hygromycin...
Showing: 1 - 6 of 6 results