Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 4 of 4 results
  1. Molecular Biology Reference

    Type
    Guide
    ... Leu L UUA, UUG, CUU, CUC, CUA, CUG Lysine Lys K AAA, AAG Methionine Met M AUG Phenylalanine Phe F UUU...PKKKRKV or PKKKRKVG Protein C EDQVDPRLIDGK S Tag KETAAAKFERQHMDS SB1 PRPSNKRLQQ Webpage and Blog References ...
  2. Sequencing Primers

    Type
    Guide
    ...gene M13 Reverse CAGGAAACAGCTATGAC In lacZ gene M13/pUC Forward CCCAGTCACGACGTTGTAAAACG (Invitrogen) In...NOS-F GCGTTCAAAAGTCGCCTAAG Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe...SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence, reverse primer T3 GCAATTAACCCTCACTAAAGG T3 promoter...to 3′. Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC ...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...
  3. CRISPR Guide

    Type
    Guide
    ...thermophilus (ST) 3' NNAGAAW Treponema denticola (TD) 3' NAAAAC Additional Cas9s from various species PAM sequence...
  4. Promoters

    Type
    Guide
    ...can initiate. The TATA box is a DNA sequence (5'-TATAAA-3') within the core promoter region where general...
Showing: 1 - 4 of 4 results