Skip to main content

We narrowed to 7 results for: gateway

Showing: 1 - 7 of 7 results
  1. Molecular Cloning Techniques

    Type
    Guide
    ...completed via Gateway cloning. Addgene's collection contains thousands of Gateway donor , Gateway entry , and...backbone. Created with BioRender.com. Gateway Recombination Cloning Gateway cloning is a recombination-based...experimental goal. Although Gateway cloning is a simple and efficient cloning method, Gateway vectors and recombination...conditions. Read more in our Gateway Cloning blog post . Figure 2: Summary of Gateway cloning. Created with ...Molecular Cloning Techniques Restriction Enzyme Gateway TOPO Gibson Golden Gate & MoClo Ligation Independent...recombination-based cloning method. During Gateway, moving a piece of DNA from one plasmid into another is done via a single...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’...
  2. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  3. Sequencing Primers

    Type
    Guide
    ...GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse...
  4. Adenovirus Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  7. Molecular Biology Reference

    Type
    Guide
    ...fragment. Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones...
Showing: 1 - 7 of 7 results