Skip to main content
Addgene

We narrowed to 7 results for: gateway

Showing: 1 - 7 of 7 results
  1. Cloning

    Type
    Guide
    ...Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway... Gateway® cloning is a recombination based cloning method. The benefit of Gateway® is that moving a piece...cassettes). Although gateway cloning is a simple and efficient cloning method, gateway vectors and recombination...Guide Genome Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’...sequence. This fragment can then be cloned into a gateway donor plasmid which contains compatible attP sites...it can be rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via...
  2. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  3. Sequencing Primers

    Type
    Guide
    ...GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse...
  4. Adenovirus Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  7. Molecular Biology Reference

    Type
    Guide
    ...fragment. Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you ...
Showing: 1 - 7 of 7 results