Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 6 results for: mme

Showing: 1 - 6 of 6 results

  1. Molecular Biology Reference

    Type
    Guide
    ...or LB agar plates. Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin...deadly to humans. The majority of all common, commercial lab strains of E. coli used today are descended...included a small number of E. coli strains below and recommend checking out these two Addgene blog posts relating...antibiotics commonly used in the lab and their recommended concentrations. We suggest checking your plasmid's...antibiotic powder can be dissolved in dH 2 0. Addgene recommends making 1000X stock solutions and storing aliquots...

  2. Sequencing Primers

    Type
    Guide
    ... CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT... CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT...

  3. CRISPR Guide

    Type
    Guide
    ...the rest of the genome The target is present immediately adjacent to a P rotospacer A djacent M otif (...well as additional DNA matching the sequence immediately upstream and downstream of the target site (termed...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be problematic.... T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C., Stan...

  4. Chemogenetics Guide

    Type
    Guide
    ...DREADDs and LMOs have been developed and are also commercially available. Browse our collection of Ready-to-use...Mouravlev A, Carpenter JC, Snowball A, Knauss S, von Schimmelmann M, During MJ, Lignani G, Schorge S, Young D,...

  5. Guide to Using Pooled Libraries

    Type
    Guide
    ...next-generation sequencing of the maxiprep DNA is recommended to verify that the library is complete - an incomplete...

  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...keep up with the demand of clinical studies and commercial purposes. The use of helper-free production cell...
Showing: 1 - 6 of 6 results