We narrowed to 7 results for: mme
-
TypeGuide...bacterial cultures . Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin...which are deadly to humans. Most of all common, commercial lab strains of E. coli used today are descended...included a small number of E. coli strains below and recommend checking out Addgene’s blog posts about common...antibiotics commonly used in the lab and their recommended concentrations. We suggest checking your plasmid's...
-
Sequencing Primers
TypeGuide...Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG...Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT...Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE) Forward pMT2-F TTGCCTTTCTCTCCACAGGT... -
CRISPR Guide
TypeGuide...the rest of the genome The target is present immediately adjacent to a P rotospacer A djacent M otif (...well as additional DNA matching the sequence immediately upstream and downstream of the target site (termed...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be problematic.... T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C., Stan... -
Chemogenetics Guide
TypeGuide...DREADDs and LMOs have been developed and are commercially available. Table 4: Common promoters in chemogenetics...Carpenter, J. C., Snowball, A., Knauss, S., von Schimmelmann, M., During, M. J., Lignani, G., Schorge, S.... -
Guide to Using Pooled Libraries
TypeGuide...next-generation sequencing of the maxiprep DNA is recommended to verify that the library is complete - an incomplete... -
Gamma-Retroviral Vector Guide
TypeGuide...keep up with the demand of clinical studies and commercial purposes. The use of helper-free production cell... -
Plan Your Experiment
TypeGuide...delivery and the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature...