We narrowed to 6 results for: tet on
-
TypeGuide... tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer...forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI, forward primer pBRforEco... primer pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI, reverse primer pCAG-...GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward...
-
Plan Your Experiment
TypeGuide... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain... -
Molecular Biology Reference
TypeGuide...England Biolabs F' proA+B+ lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be... -
CRISPR Guide
TypeGuide...- activation through increased H3K27 acetylation TET1 - activation through cytosine demethylation DNMT3A... a companion CRISPRon to undo repression using a TET1-dCas9 fusion. Figure 10: Overview of epigenetic ... -
Promoters
TypeGuide...from phospholycerate kinase gene TRE Inducible Tetracycline response element promoter U6 Constitutive Human... -
Lentiviral Vector Guide
TypeGuide...LEDGF (also known as PSIP1 or p75 ), a lentiviral tethering gene that helps facilitate integration. Despite...