Skip to main content

We narrowed to 5 results for: tet on

Showing: 1 - 5 of 5 results
  1. Sequencing Primers

    Type
    Guide
    ...' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R...origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI site Forward pBRforEco ...Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG...GAGTCACTTTAAAATTTGTATACAC ADH terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward...
  2. Promoters

    Type
    Guide
    ...as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The Promoter...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...
  3. Molecular Biology Reference

    Type
    Guide
    ...England Biolabs F' proA+B+ lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Carbenicillin can be used...
  4. CRISPR Guide

    Type
    Guide
    ...— activation through increased H3K27 acetylation TET1 — activation through cytosine demethylation DNMT3A... a companion CRISPRon to undo repression using a TET1-dCas9 fusion. Figure 10: Overview of epigenetic ...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...LEDGF (also known as PSIP1 or p75 ), a lentiviral tethering gene that helps facilitate integration. Despite...
Showing: 1 - 5 of 5 results