...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer... tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer... Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG...

...expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 ... in a single lentiviral transfer vector or separate transfer vectors May contain reporter gene (e.g. GFP...lines (for details, see Plasmids 101: Mammalian Vectors ) Transient or stable expression of Cas9 and/or...CRISPR elements are inserted into an AAV transfer vector and used to generate AAV particles (for details...oligos and clone these oligos into your desired vector. In many cases, targeting oligos are synthesized... exact cloning strategy will depend on the gRNA vector you have chosen, so it is best to review the protocol...

...destination vector (in this case the destination vector would be the lentiviral transfer vector). The destination...insert of interest from its parent vector and ligating into a second vector in such as way that the insert...later be digested from this new vector and cloned into the lentiviral vector. This is basically shuffling...between vectors until the gene of interest is flanked by sites compatible with those in the vector into ...site (MCS) from a separate vector into the single site in the lentiviral vector and generate more useful...by the design of the vectors and by safe laboratory practice. In terms of vector design, 2nd and 3rd generation...components of the virus onto different vectors. The transfer vector encodes the gene of interest and contains...

...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...expression (for the purposes of gene study). Expression vectors must contain a promoter sequence, a transcription...the transcription process to stop. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...based genome engineering from a single lentiviral vector. Nucleic Acids Research , 42 (19), e147. PMID: ...

... Promoters are a vital component of expression vectors because they control the binding of RNA polymerase...from phospholycerate kinase gene TRE Inducible Tetracycline response element promoter U6 Constitutive Human...