Skip to main content

We narrowed to 6 results for: tet on vector

Showing: 1 - 6 of 6 results
  1. Sequencing Primers

    Type
    Guide
    ... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...For pBluescript vector Forward pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' ...
  2. Promoters

    Type
    Guide
    ...as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The Promoter... Promoters are a vital component of expression vectors because they control the binding of the RNA polymerase...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...
  3. Molecular Biology Reference

    Type
    Guide
    ...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...usually for the purposes of gene study. Expression vectors must contain a promoter sequence, a transcription... sequence, and the inserted gene. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...
  4. Lentiviral Vector Guide

    Type
    Guide
    ...Guides Viral Vectors Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral...’s viral vector protocols . Figure 5: Overview of lentiviral vector production. Viral Vector Integration...Viral Vectors 101 topics More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...gamma-retroviruses, see Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically...Lentiviral Vectors Due to their integration and long-term expression of a transgene, lentiviral vectors are ...
  5. CRISPR Guide

    Type
    Guide
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...based genome engineering from a single lentiviral vector. Nucleic Acids Research , 42 (19), e147. PMID: ...
  6. Optogenetics Guide

    Type
    Guide
    ... the placement of the optic fiber. Using viral vectors for opsin delivery results in more localized expression...rather than in all cells. For example, using a viral vector with a floxed opsin in a VGAT-Cre animal will result...illumination, allowing activity; Dronpa145N homotetramerizes, Dronpa145K and Dronpa145N dimerize with each...
Showing: 1 - 6 of 6 results