Skip to main content

We narrowed to 24 results for: Numb

Showing: 1 - 20 of 24 results
  1. CRISPR Library Amplification

    Type
    Protocol
    ...100 x 100 x 100 ÷ 0.1 This number should be at least 1000X greater than number of perturbations in library...plasmids and can be scaled according to the actual number. Required Quality Control (QC) Pooled libraries...individual plasmids. For larger libraries scale the number of cells and DNA accordingly. Pro-Tip Use of extreme...order to be enumerated accurately. Frequently the number of colonies can be too great to count. Ideally,...a given plate (example: by increasing the total number of bioassay plates used). Scaling up the experiment...Maxiprep protocol, scale the reagent volume and column number as needed. The use of Mega or Gigapreps is acceptable...acceptable when scaling up or reducing the number of tandem purifications. Consult the manufacturers handbooks...
  2. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...present in large numbers, 50 or more per cell, and have a high copy number. High copy number plasmids should...copy and low copy plasmids? The copy number refers to the number of copies of an individual plasmid within... of bacteria and is used to grow up sufficient numbers of bacteria necessary to isolate enough plasmid...Figure 2). Large plasmids usually have a low copy number (approximately one or two copies per cell) and ...
  3. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...transfection. Test a variety of brands and FBS lot numbers to find one suitable with your protocols. FBS can...-Tip Transducing too many cells relative to the number of virus particles reduces the transduction efficiency...massive cell death upon antibiotic selection. The number of cells transduced should be enough that they ...amount of time, but not so many that they vastly outnumber the virus particles. Incubate the cells with the...lentivirus used, cells may also exhibit varying numbers of integration events. In other words, if an MOI...
  4. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ...to insert ratio of approximately 1:3. Since the number of base pairs for each varies, it is difficult ...the more common chemically-competent cells. The number of bacterial colonies resulting from your transformation... plate that are not correct. If you have a high number of colonies on your recipient plasmid alone plate... ligations. Pick 3-10 colonies depending on the number of background colonies on your control plate (the...
  5. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...100uM stock of any primer, add a number of µl of dH 2 O equal to the number of nanomoles of DNA times 10....by creating a “master mix,” which minimizes the number of small volumes you need to pipet. If you are ...Preparation Multiply the volume of each reagent by the number of individual PCRs you wish to perform and add ...
  6. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...to insert ratio of approximately 1:3. Since the number of base pairs for each varies, it is difficult ...the more common chemically-competent cells. The number of bacterial colonies resulting from your transformation... plate that are not correct. If you have a high number of colonies on your recipient plasmid alone plate... ligations. Pick 3-10 colonies depending on the number of background colonies on your control plate (the...
  7. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...Determine the number of genome-containing particles in an AAV prep using qPCR, SYBR Green Technology,...Titration protocol can be used to determine the number of genome-containing particles of an AAV prep using... step Reagent Preparation Master Mix: Count the number of samples (n) and prepare master mix for an additional...
  8. Pouring LB Agar Plates

    Type
    Protocol
    ...colonies Pro-Tip If you will be screening a large number of colonies, we recommend using larger plates. ...precise mass you measure out will be based on the number of plates you’d like to pour. For example: Because...down with a paper towel. Count out the appropriate number of plates and stack them on your lab bench. Label...
  9. Lentivirus ddPCR Titration

    Type
    Protocol
    ... transducing units and generally represents the number of infectious viral particles. Users may need to...primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244 Reagent ...1600 To calculate the titers, first calculate the number of viruses per cellular genome: Since the cellular...
  10. Fluorescence Titering Assay

    Type
    Protocol
    ... {N*F*D\over V_T}$$ Where: T = Titer, TU/mL N = Number of cells transduced F = Fraction of cells with ... = {N*F\over V_V}$$ Where: T = Titer, TU/mL N = Number of cells transduced F = Fraction of cells with ...
  11. Pipetting Protocol

    Type
    Protocol
    ... with the appropriate tips, which are made in a number of sizes and colors depending on the pipette they...Although each pipette performs the same function, the numbers are read differently on each type of pipette. This...
  12. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...heterogenous polyclonal population that varies in the number of integration events and the site(s) of proviral...cells but can be modified for suspension cells. The number of monoclonal lines generated using this protocol...
  13. AAV Production in HEK293 Cells

    Type
    Protocol
    ...means to scale-up without having to handle a large number of T-175 flasks. Workflow Timeline Day 0: Seed ...would like 2 mg of DNA or 2000 μg. Using the total number of base pairs from all three plasmids, we can determine...
  14. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...: MOI (multiplicity of infection) refers to the number of infecting viral particles per cell. Addgene ...following recommendations are guidelines for the number of days you should wait until harvesting your cells...
  15. Weighing Reagents Protocol

    Type
    Protocol
    ...above has a capacity of 200 g, as indicated by the number above the "Zero" button. Before weighing out your...
  16. Water Bath Protocol

    Type
    Protocol
    ...baths with instructions on the bottle, for example, number of drops per liter. Place a thermometer in the ...
  17. Centrifugation

    Type
    Protocol
    ...dangerous for the user. If you do not have a balanced number of samples, you may need to add a blank. Blanks...
  18. Gibson Assembly Protocol

    Type
    Protocol
    ...with normal PCR primers (Gibson et al. , 2010). Number of fragments assembled simultaneously Multiple ...
Showing: 1 - 20 of 24 results