We narrowed to 23 results for: tac

...transfer stack. Set the Top Stack to one side and discard the white separator. Keep the Bottom Stack in the...Top Stack such that the electrical contacts are aligned with the corresponding electrical contacts on ...tray. Place the Bottom Stack on the blotting surface. Align the electrical contacts on the blotting surface...Prestained protein ladder Ethanol iBlot 2 PVDF Mini Stack, Thermo Fisher IB24002 20X TBS Tween-20 Nonfat milk...place it on the transfer membrane of the bottom stack. Soak a piece of iBlot Filter Paper in deionized... the air bubbles with the roller. Place the Top Stack over the pre-soaked filter paper. Remove air bubbles...

...flask, Corning 430825, 175 cm 2 Cellstack 5, Corning 3319, 3180 cm 2 Cellstack 2, Corning 3269, 1272 cm 2 ...-3 minutes for cells to detach. Gently tap the sides of the CS2 to help detach the cells, add 200 mL of...used to produce AAV from one Five Chambers Cell-Stack (CS5) (Link opens in a new window) (3,180 cm 2 -...the same surface area as 21 x T-175 flasks). Cell stacks provide an efficient means to scale-up without ...Pro-Tip While adherent, these cells are very loosely attached to the dish surface and should be handled carefully...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 1 mg/mL Polyethylenimine (...covered with media. 293T cells are delicate and detach very easily - media should always be added away...

...(AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG...Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to ...Lentiviral Particles Before this step, you must contact your institution’s Bio-Safety office to receive...the OPTI-MEM – do not allow FuGENE® to come in contact with the walls of the tube before it has been diluted... 10% bleach. Laboratory materials that come in contact with viral particles should be treated as biohazardous...questions about what safety practice to follow, please contact your institution’s safety office. For more information...

...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR...

...supervisor what is available and the appropriate contact times for each agent. Make sure you have enough... while working, you may accidentally come into contact with hazardous materials. A sink, eyewash station...must be clearly marked as “BSL-2.” The names and contact information of the laboratory manager should be...

...the cells have detached from the plate and can be isolated. When trypsinized, detached cells will exhibit...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin EDTA (TrypLE, Thermo...

...GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5' = 28 bp We also need...TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT - 5' Note: We could...

.... After ligation, the insert DNA is physically attached to the backbone and the complete plasmid can be... water + Any colonies indicate contamination of intact plasmid in ligation or transformation reagents ...

... Count out the appropriate number of plates and stack them on your lab bench. Label the plates with the... of the plate. Cap each plate after pouring and stack as you pour. If your agar partially solidifies in...

...gently pour off the ethanol storage buffer. Tightly attach LabMate PD10 Buffer Reservoirs to the top of the...columns, refer to the manufacturer’s instructions. Attach the Gravitrap column to a clamp on a clamp stand...

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin EDTA (TrypLE, Thermo..., using a new aspirating pipette for each well. Detach cells by incubating with 200 µL TrypLE for 1–2 ...

...a different sequence than expected and wish to contact Addgene about the accuracy of your plasmid, please...

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45 μm polyethersulfone filter...

... for ligation of inserts to vectors than for an intact control plasmid. Incubate the competent cell/DNA...

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45 μm polyethersulfone filter...

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.1% Crystal Violet, Ward’...

...observations. Some microscopes have digital cameras attached to them that allow you to capture images directly...

...place the tip near the bottom of and gently in contact with the container (capillary action between the...

...below the 60–40% interface with an 18 ga needle attached to a 10 mL syringe. The bevel of the needle should...

...careful, the pellet is harder to see and less well attached to the tube after the 70% ethanol wash. You can...