...would fail Addgene QC and would not be used. Section 3: Image Analysis Use ImageJ or a similar photo software...protein bands as follows: Select Analyze . Figure 3 Select Gels . Select Plot Lanes . One graph per lane...Sample Peak 1 (contaminant) Peak 2 (contaminant) Peak 3 (HC) Peak 4 (LC) Total Area HC + LC Area Purity AR0018... Recombinant Antibodies Recombinant Antibody Purification Protocol Molecular Biology Reference Introduction...mobility of the bands (sample AR0016 in Figure 1) indicates that the samples may not have been processed correctly...ImageJ. Select File . Select Open . Choose the location of the file to open. Change the image type to ...select the Chart Type drop down menu and select Scatter chart. Change the data range and select the cells...

...recipient plasmid to insert ratio of approximately 1:3. Since the number of base pairs for each varies, it...colonies and check them for successful ligations. Pick 3-10 colonies depending on the number of background ...vector by gel purification Run your digested DNA on an agarose gel and conduct a gel purification to isolate... not cut within your insert Are in the desired location in your recipient plasmid (usually in the Multiple...plasmids. Because you lose some DNA during the gel purification step, it is important to digest plenty of starting...prior to the ligation step or prior to the gel purification step, depending on the phosphatase you choose...isolate the DNA. When running a gel for purification purposes it is important to have nice crisp bands and...

...VWR, EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10 mg/mL, Millipore, TR-1003-G Molecular...mL glutaGRO 50 U/mL benzonase: 15 mL DMEM Complete 3 µL of 250 U/µL benzonase Procedure Transducing Cells...0.03887375114 6.22E+06 2 400 768 18360 0.08366013072 6.69E+06 3 200 1620 15840 0.2045454545 8.18E+06 4 100 3180 20540... sample. This protocol was modified from the publication Wang et al. (2018) . Before Starting Thaw the...Scientific, 10199-452 Reagents GeneJet Genomic DNA Purification Kit, Thermo Fisher, K0721 6-well tissue culture...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin...FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...

...different buffers and do not use water). Microwave for 1-3 min until the agarose is completely dissolved (but...concentration of approximately 0.2-0.5 μg/mL (usually about 2-3 μl of lab stock solution per 100 mL gel). EtBr binds... length in base pairs) for visualization and purification. Electrophoresis uses an electrical field to...instructions on how to do this, visit the Gel Purification page. Tips and FAQ How do you get better resolution...

...70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized DNA Purification Grow an overnight culture....5 volumes 95% or 100% ethanol and 1/10 volume of 3 M Na-acetate (pH 4.8). Invert the microfuge tube to... Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and Isolating Bacteria Inoculating...instructions. If you want to perform plasmid purification without using a kit, you can find a protocol...using. Store DNA at 4°C. Tips and FAQ Plasmid purification kits provide the fastest way to obtain a high...

... the last section of the plate, to create streak #3. Incubate plate with newly plated bacteria overnight...plate to inoculate a bacterial culture for DNA purification will minimize the chance of having a mixture...

...Addgene's plasmid information pages recommend 5’ and 3’ sequencing primers. These primers typically anneal...Although your sequencing results may indicate bases at specific locations, by looking at the trace file, you...Diagnostic Restriction Digest Introduction Sequence verification of important plasmid features (such as the gene...file and use the search feature in the program to locate the incorrect sequence. Look at the peaks in the...after base 70 there are multiple peaks in the same location. Looking at the trace file will give you more...

...Scientific, 10199-452 Ice bucket 96-well freezer blocks (x 3) Reagents Molecular Biology Grade Water, Hyclone, ...20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution 3 (20X): 5 µL in 95 µL 1X PCR buffer (1:8,000) Dilution...post on ddPCR for AAV quantification. This protocol was modified from the publication Lock et al. (2014) ...

...are using disinfectants as described above in step 3. You will also need to maintain the appropriate water...bring your materials to a particular temperature, catalyze chemical reactions such as restriction digests...

...transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for 30-60 secs ...bacteria are used as the means for both storing and replicating plasmids. Because of this, nearly all plasmids...expression) carry both a bacterial origin of replication and an antibiotic resistance gene for use as ...bacteria. Scientists have made many genetic modifications to create bacterial strains that can be more...plasmid DNA for the purposes of storage and amplification. Higher efficiency cells are more important ...

.... Boil the samples for 10 min at 100 °C . Section 3: SDS-PAGE Prepare the precast gel as follows: Remove...Immunocytochemistry Protocol Recombinant Antibody Purification Protocol Molecular Biology Reference Introduction...lysis buffer will vary depending on the cellular location of the protein of interest. RIPA buffer is suitable...most proteins but more stringent buffers and a sonication step may be required for hard to extract proteins...BSA standard that range from 0–2000 µg/mL . In duplicate, dilute 10 µL of standard, blank, and lysate samples... nm . Calculate the average absorbance of the duplicate samples on the plate. Subtract the average absorbance...vary depending on the sample type and cellular location of the protein of interest. You may need to try...

...hand for 10 seconds. Incubate the sample(s) for 2-3 minutes on ice and centrifuge for 15 minutes at 12,000...You may also like... Kit-Free DNA Purification Agarose Gel Purification Molecular Biology Reference Introduction...information on nucleic acid quantification, see our protocol for DNA quantification , which can be modified... not affect the quality of RNA or downstream applications. To improve yield of RNA, instead of incubating...

...on plates without any antibiotic. Negative Result 3: Only the Non-resistant Strain Grows If only the non-resistant...Tetracycline 10 mg/mL 10 µg/mL Notes: Unless otherwise indicated, the antibiotic powder can be dissolved in dH ...test results. Sample Data In all cases below (-) indicates that the tested strain is not supposed to be resistant... resistant to the antibiotic, (+) indicates that the tested strain is supposed to be resistant to the ...

...stable cell pool were then expanded for an additional 3 weeks under blasticidin selection. Anti-Cas9 Western...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin...orange/yellow if using a standard phenol red pH indicator) because the buildup of waste products could be...