
Addgene Plasmid 10878. Protocol Version 1.0. December 2006.
Copyright Addgene 2006, All Rights Reserved. This protocol is provided for your convenience. See “warranty information” in appendix.
A.1 The RNAi Consortium
The pLKO.1 cloning vector is the backbone upon which The RNAi Consortium has built a library of shRNAs directed against 15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this shRNA cloning vector available to the scientific community. Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 ('PubMed”:http://www.ncbi.nlm.nih.gov/pubmed/16564017?dopt=abstract) in all publications arising from the use of this vector.
A.2 Map of pLKO.1
pLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC for expression of shRNAs. pLKO.1 can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target cell line. Once introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection.

Figure 1 : Map of pLKO.1 containing an shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI. shRNA oligos are cloned into the AgeI and EcoRI sites in place of the stuffer. The AgeI site is destroyed in most cases (depending on the target sequence), while the EcoRI site is preserved. For a complete map of pLKO.1 containing the 1.9kb stuffer, visit www.addgene.org/10878.
| Description | Vector Element |
|---|---|
| U6 | Human U6 promoter drives RNA Polymerase III transcription for generation of shRNA transcripts. |
| cPPT | Central polypurine tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector’s preintegration complex in the transduced cells. |
| hPGK | Human phosphoglycerate kinase promoter drives expression of puromycin. |
| Puro R | Puromycin resistance gene for selection of pLKO.1 plasmid in mammalian cells. |
| sin 3’LTR | 3’ Self-inactivating long terminal repeat. |
| f1 ori | f1 bacterial origin of replication. |
| Amp R | Ampicillin resistance gene for selection of pLKO.1 plasmid in bacterial cells |
| pUC ori | pUC bacterial origin of replication. |
| 5’LTR | 5’ long terminal repeat. |
| RRE | Rev response element. |

A.3 Related Products
The following plasmids available from Addgene are recommended for use in conjunction with the pLKO.1 TRC-cloning vector.
| Plasmid (Addgene ID #) | Description |
|---|---|
| pLKO.1 – TRC control | Negative control vector containing non-hairpin insert. |
| pLKO.1 – scramble shRNA | Negative control vector containing scrambled shRNA. |
| psPAX2 | Packaging plasmid for producing viral particles. |
| pMD2.G | Envelope plasmid for producing viral particles. |
Note: pLKO.1 can also be used with packaging plasmid pCMV-dR8.2 dvpr and envelope plasmid pCMV-VSVG from Robert Weinberg’s lab. For more information, visit Addgene’s Mammalian RNAi Tools page.
Several other laboratories have deposited pLKO derived vectors that may also be useful for your experiment. To see these vectors, visit Addgene’s website and “search for “pLKO”“.
B.1 Determining the Optimal 21-mer Targets in your Gene
Selection of suitable 21-mer targets in your gene is the first step toward efficient gene silencing. Methods for target selection are continuously being improved. Below are suggestions for target selection.
1. Use an siRNA selection tool to determine a set of top-scoring targets for your gene. For example, the Whitehead Institute for Biomedical Research hosts an siRNA Selection Program that can be accessed after a free registration (http://jura.wi.mit.edu/bioc/siRNAext/). If you have MacOS X, another excellent program is iRNAi, which is provided free by the company Mekentosj (http://www.mekentosj.com/irnai/).
A summary of guidelines for designing siRNAs with effective gene silencing is included here:
2. To minimize degradation of off-target mRNAs, use NCBI’s BLAST program. Select sequences that have at least 3 nucleotide mismatches to all unrelated genes.
Addgene recommends that you select multiple target sequences for each gene. Some sequences will be more effective than others. In addition, demonstrating that two different shRNAs that target the same gene can produce the same phenotype will alleviate concerns about off-target effects.
B.2 Ordering Oligos Compatible with pLKO.1
To generate oligos for cloning into pLKO.1, insert your sense and antisense sequences from step B.1 into the oligos below. Do not change the ends; these bases are important for cloning the oligos into the pLKO.1 TRC-cloning vector.
Forward oligo:
5’ CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3’
Reverse oligo:
5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3’
For example, if the target sequence is (AA)TGCCTACGTTAAGCTATAC, the oligos would be:
Forward oligo:
5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’
Reverse oligo:
5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’
The pLKO.1-TRC cloning vector contains a 1.9kb stuffer that is released upon digestion with EcoRI and AgeI.
The oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1 vector, producing a final plasmid that expresses the shRNA of interest.
C.1 Recommended Materials
| Material | Vendor and catalog # |
|---|---|
| AgeI | New England Biolabs (NEB) #R0552S |
| EcoRI | NEB #R0101S |
| T4 DNA ligase | NEB #M0202S |
| NEB buffer 2 | NEB #B7002S |
| DH5 alpha competent cells | Invitrogen #18258-012 |
| Qiaquick gel extraction kit | Qiagen #28704 |
| Low melting point agarose | Sigma #A9414 |
| Luria Broth Agar (LB agar) | American Bioanalytical: #AB01200-02000 |
| Ampicillin | VWR: #7177-48-2. Use at 100 μg/mL. |
| Carbenicillin | VWR: #80030-956. Use at 100 μg/mL. |
C.2 Annealing Oligos
1. Resuspend oligos in ddH2O to a concentration of 20 μM, then mix:
5 μL Forward oligo
5 μL Reverse oligo
5 μL 10x NEB buffer 2
35 μL ddH2O
2. Incubate for 4 minutes at 95°C in a PCR machine or in a beaker of boiling water.
3. If using a PCR machine, incubate the sample at 70°C for 10 minutes then slowly cool to room temperature over the period of several hours. If using a beaker of water, remove the beaker from the flame, and allow the water to cool to room temperature. This will take a few hours, but it is important for the cooling to occur slowly for the oligos to anneal.
C.3 Digesting pLKO.1 TRC Cloning Vector
1. Digest pLKO.1 TRC-cloning vector with AgeI. Mix:
6 μg pLKO.1 TRC-cloning vector (maxiprep or miniprep DNA)
5 μL 10x NEB buffer 1
1 μL AgeI
to 50 μL ddH2O
> Incubate at 37°C for 2 hours.
2. Purify with Qiaquick gel extraction kit. Elute in 30 μL of ddH2O.
3. Digest eluate with EcoRI. Mix:
30 μL pLKO.1 TRC-cloning vector digested with AgeI
5 μL 10x NEB buffer for EcoRI
1 μL EcoRI
14 μL ddH2O
> Incubate at 37°C for 2 hours.
4. Run digested DNA on 0.8% low melting point agarose gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. Cut out the 7kb band and place in a sterile microcentrifuge tube.
When visualizing DNA fragments to be used for ligation, use only long-wavelength UV light. Short wavelength UV light will increase the chance of damaging the DNA.
5. Purify the DNA using a Qiaquick gel extraction kit. Elute in 30 μL of ddH2O.
6. Measure the DNA concentration.
C.4 Ligating and Transforming into Bacteria
1. Use your ligation method of choice. For a standard T4 ligation, mix:
2 μL annealed oligo from step C.2.
20 ng digested pLKO.1 TRC-cloning vector from step C.3. (If you were unable to measure the DNA concentration, use 1 μL)
2 μL 10x NEB T4 DNA ligase buffer
1 μL NEB T4 DNA ligase
to 20 μL ddH2O
> Incubate at 16°C for 4-20 hours.
2. Transform 2 μL of ligation mix into 25 μL competent DH5 alpha cells, following manufacturer’s protocol. Plate on LB agar plates containing 100 μg/mL ampicillin or carbenicillin (an ampicillin analog).
You may screen for plasmids that were successfully ligated by restriction enzyme digestion. However, once you have identified the positive clones, it is important to verify the insert by conducting a sequencing reaction.
D.1 Recommended Materials
| Material | Vendor and catalog # |
|---|---|
| DNA Miniprep Kit | Qiagen #27104 |
| EcoRI | NEB #R0101S |
| NcoI | NEB #R0193S |
| Agarose | Sigma #A9539 |
D.2 Screening for Inserts
Day 1:
1. Innoculate 5 colonies from each ligation into LB + 100 μg/mL ampicillin or carbenicillin.
Day 2:
2. Spin down the cultures and use a miniprep kit to obtain DNA.
3. Conduct a restriction digest with EcoRI and NcoI:
> Incubate at 37°C for 1-2 hours.
4. Run the digestion products on a 1% agarose gel. You should see two fragments, a 2kb fragment and a 5kb fragment.
5. Sequence positive clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’).
You may need to adjust the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure of the hairpin sequence.
Before this step, you must contact your institution’s Bio-Safety office to receive permission and institution-specific instructions. You must follow safety procedures and work in an environment (e.g. BL2+) suitable for handling HIV-derivative viruses.
For transient knockdown of protein expression, you may transfect plasmid DNA directly into the target cells. The shRNA will be expressed, but the DNA is unlikely to be integrated into the host genome.
For stable loss-of-function experiments, Addgene recommends that you generate lentiviral particles and infect the target cells. Addition of puromycin will allow you to select for cells that stably express your shRNA of interest.
E.1 Recommended Materials
| Material | Vendor and catalog # |
|---|---|
| psPAX2 | Addgene #12260 |
| pMD2.G | Addgene #12259 |
| HEK-293T cells | GenHunter: #Q401 |
| FuGENE® 6 Transfection Reagent | Roche Applied Biosciences: #11814443001 |
| OPTI-MEM® serum-free media | Invitrogen: #31985 |
| Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen: #11995 |
| Fetal Bovine Serum (FBS) | Invitrogen: #16000 |
| Penicillin/Streptomycin | Invitrogen: #15140-122 |
| Polypropylene tubes | VWR: #87003-290 |
Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and pCMV-VSVG from the Robert Weinberg lab. For more information, visit Addgene’s Mammalian RNAi Tools page.
E.2 Protocol for Producing Lentiviral Particles
This protocol is for transfection in a 6 cm plate. The protocol can be scaled to produce different amounts of virus as needed.
Day 1:
a. For each plasmid to be transfected, plate 7×105 HEK-293T cells in 5 mL of media in a 6 cm tissue culture plate. Incubate cells at 37oC, 5% CO2 overnight.
Although cells should regularly be passaged in DMEM + 10% FBS with penicillin/streptomycin, cells should be plated at this step in DMEM + 10% FBS without antibiotics (no penicillin or streptomycin).
Day 2:
b. Perform the transfection in the late afternoon because the transfection mix should only be incubated with the cells for 12-15 hours.
c. In polypropylene microfuge tubes (do NOT use polystyrene tubes), make a cocktail for each transfection:
You may want to vary the ratio of shRNA plasmid, packaging plasmid, and envelope plasmid to obtain the ratio that gives you the optimal viral production.
d. Create a master mix of FuGENE® 6 transfection reagent in serum-free OPTI-MEM. Calculate the amount of Fugene® and OPTI-MEM necessary given that each reaction will require 6 μL FuGENE® + 74 μL OPTI-MEM. For example:
In a polypropylene tube, add OPTI-MEM first. Pipette FuGENE® directly into the OPTI-MEM – do not allow FuGENE® to come in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking the tube. Incubate for 5 minutes at room temperature.
e. Add 80 μL of FuGENE® master mix to each tube from step c for a total volume of 100 μL. Pipette master mix directly into the liquid and not onto the walls of the tube. Mix by swirling or gently flicking the tube.
f. Incubate for 20-30 minutes at room temperature.
g. Retrieve HEK-293T cells from incubator. The cells should be 50-80% confluent and in DMEM that does not contain antibiotics.
h. Without touching the sides of the dish, gently add DNA:FuGENE® mix dropwise to cells. Swirl to disperse mixture evenly. Do not pipette or swirl too vigorously, as you do not want to dislodge the cells from the plate.
i. Incubate cells at 37°C, 5% CO2 for 12-15 hours.
Day 3:
j. In the morning, change the media to remove the transfection reagent. Replace with 5 mL fresh DMEM + 10% FBS + penicillin/streptomycin. Pipette the media onto the side of the plate so as not to disturb the transfected cells.
k. Incubate cells at 37°C, 5% CO2 for 24 hours.
Day 4:
l. Harvest media from cells and transfer to a polypropylene storage tube. The media contains your lentiviral particles. Store at 4°C.
m. Add 5 mL of fresh media containing antibiotics to the cells and incubate at 37°C, 5% CO2 for 24 hours.
Day 5:
n. Harvest media from cells and pool with media from Day 4. Spin media at 1,250 rpm for 5 minutes to pellet any HEK-293T cells that were inadvertently collected during harvesting.
In lieu of centrifugation, you may filter the media through a 0.45 μm filter to remove the cells. Do not use a 0.2 μm filter, as this is likely to shear the envelope of your virus.
o. Virus may be stored at 4°C for a few days, but should be frozen at -20°C or -80°C for long-term storage.
Freeze/thaw cycles decrease the efficiency of the virus, so Addgene recommends that you use the virus immediately or aliquot the media into smaller tubes to prevent multiple freeze/thaw cycles.
Lentiviral particles can efficiently infect a broad range of cell types, including both dividing and non-dividing cells. Addition of puromycin will allow you to select for cells that are stably expressing your shRNA of interest.
F.1. Recommended Materials
| Material | Vendor and catalog # |
|---|---|
| Hexadimethrine bromide (polybrene)* | Sigma-Aldrich: #H9268 |
| Protamine Sulfate* | MP Biomedicals: #194729 |
| Puromycin* | Sigma-Aldrich: #P8833 |
| Target cells | Varies based on your experiment |
| Culture media for target cells | Varies based on your experiment |
| Materials for assay | Varies based on your experiment |
F.2. Determining the Optimal Puromycin Concentration
Each cell line responds differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration for your cell line before initiating your experiment.
Day 1:
a. Plate target cells in ten 6 cm plates and grow at 37° C, 5% CO2 overnight.
Day 2:
b. The target cells should be approximately 80-90% confluent.
c. Dilute puromycin in the preferred culture media for your target cells. The final concentration of puromycin should be from 1-10 μg/mL in 1 μg/mL increments.
d. Label plates from 1-10 and add appropriate puromycin-containing media to cells.
Days 3+:
e. Examine cells each day and change to fresh puromycin-containing media every other day.
f. The minimum concentration of puromycin that results in complete cell death after 3-5 days is the concentration that should be used for selection in your experiments. (You may wish to repeat this titration with finer increments of puromycin to determine a more precise optimal puromycin concentration.)
F.3. Protocol for Lentiviral Infection and Selection
Day 1:
a. Plate target cells and incubate at 37°C, 5% CO2 overnight.
Day 2:
b. Target cells should be approximately 70% confluent. Change to fresh culture media containing 8 μg/mL polybrene.
Polybrene increases the efficiency of viral infection. However, polybrene is toxic to some cell lines. In these cell lines, substitute protamine sulfate for polybrene.
c. Add lentiviral particle solution from step E. For a 6 cm target plate, add between 0.05-1 mL virus (add ≥0.5 mL for a high MOI, and ≤0.1 mL for a low MOI). Scale the amount of virus added depending on the size of your target plate.
MOI (multiplicity of infection) refers to the number of infecting viral particles per cell. Addgene recommends that you test a range of MOIs to determine the optimal MOI for infection and gene silencing in your target cell line.
d. Incubate cells at 37°C, 5% CO2 overnight.
Day 3:
e. Change to fresh media 24 hours after infection.
If viral toxicity is observed in your cell line, you may decrease the infection time to between 4 – 20 hours. Remove the virus-containing media and replace with fresh media. Do not add puromycin until at least 24 hours after infection to allow for sufficient expression of the puromycin resistance gene.
f. To select for infected cells, add puromycin to the media at the concentration determined in step E.2.
Addgene recommends that you maintain one uninfected plate of cells in parallel. This plate will serve as a positive control for the puromycin selection.
Days 4+:
g. Change to fresh puromycin-containing media as needed every few days.
h. Assay infected cells. The following recommendations are guidelines for the number of days you should wait until harvesting your cells. However, you should optimize the time based on your cell line and assay:
| Assay | Days post-infection |
|---|---|
| mRNA knockdown (quantitative PCR) | ≥ 3 days |
| Protein knockdown (western blot) | ≥ 4 days |
| Phenotypic assay | ≥ 4 days |
BL2 safety practices should be followed when preparing and handling lentiviral particles. Personal protective clothing should be worn at all times. Use plastic pipettes in place of glass pipettes or needles. Liquid waste should be decontaminated with at least 10% bleach. Laboratory materials that come in contact with viral particles should be treated as biohazardous waste and autoclaved. Please follow all safety guidelines from your institution and from the CDC and NIH for work in a BL2 facility.
If you have any questions about what safety practice to follow, please contact your institution’s safety office.
To obtain the MSDS for this product, visit www.addgene.org/sitemap and follow the MSDS link.
H.1. Published Articles
Khvorova A et. al. 2003. Functional siRNAs and miRNAs exhibit strand bias. Cell 115:209-216. (PubMed)
Moffat J et. al. 2006. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124:1283-1298. (PubMed)
Naldini L et. al. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267. (PubMed)
Schwarz DS et. al. 2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199-208. (PubMed)
Stewart SA et. al. 2003. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 9(4):493-501. (PubMed)
Zufferey R et. al. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15(9):871-5. (PubMed)
Zufferey R et. al. 1998. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72(12):9873-80. (PubMed)
H.2. Web resources
Addgene’s mammalian RNAi website: www.addgene.org/mammalianrnai
The RNAi Consortium (TRC): www.broad.mit.edu/genome_bio/trc/rnai.html
Background on RNAi mechanism: www.nature.com/focus/rnai/animations/animation/animation.htm
Whitehead siRNA Selection Program: jura.wi.mit.edu/bioc/siRNAext/
Mekentosj iRNAi Program: www.mekentosj.com/irnai/
I.1. Sequence of pLKO.1 TRC-Cloning Vector
Click here to see the sequence of pLKO.1 TRC-cloning vector. The vector is 8901 base pairs total, and the stuffer insert is shown in all capital letters.
I.2. Recipes
Luria Broth Agar (LB agar) + antibiotic
Per 40 grams of powder from American Bioanalytical catalog # AB01200-02000, LB contains:
10g tryptone
5g yeast extract
10g sodium chloride
15g agar
> Prepare LB agar solution by dissolving 40g of LB powder in 1L of distilled water. Autoclave and cool to 55°C. Add 1mL of 100mg/mL ampicillin or carbenicillin to obtain a final concentration of 100 μg/mL antibiotic. Pour plates and store at 4°C.
Hexadimethrine Bromide (Polybrene)
Prepare a 1mg/mL solution of polybrene (Sigma-Aldrich catalog #H9268) in 0.9% NaCl. Autoclave to sterilize. Stock solution is stable at 4°C for up to one year. The powder form of polybrene is stable at 4°C for several years.
Protamine Sulfate
Store protamine sulfate (MP Biomedicals catalog #194729) at 4°C. Freely soluble in hot water and slightly soluble in cold water.
Puromycin
Prepare a 50mg/mL stock solution of puromycin (Sigma-Aldrich catalog #P8833) in distilled water. Sterilize by passing through a 0.22 μm filter. Store aliquots at -20°C.
I.3. Warranty Information
Addgene is committed to providing scientists with high-quality goods and services. Addgene makes every effort to ensure the accuracy of its literature, but realizes that typographical or other errors may occur. Addgene makes no warranty of any kind regarding the contents of any literature. Literature are provided to you as a guide and on an “AS IS” “AS AVAILABLE” basis without warranty of any kind either expressed or implied, including but not limited to the implied warranties of fitness for a particular purpose, non-infringement, typicality, safety and accuracy.
The distribution of any literature by Addgene is not meant to carry with it, and does not grant any license or rights of access or use to the materials described in the literature.
The distribution of materials by Addgene is not meant to carry with it, and does not grant any license, express or implied, under any patent. All transfers of materials from Addgene to any party are governed by Addgene’s Terms of Use, Addgene’s Terms of Purchase, and applicable Material Transfer Agreements between the party that deposited the material at Addgene and the party receiving the material.