-
PurposeExpresses ThermoCas9 and its sgRNA module
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100981 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNW33n
- Backbone size w/o insert (bp) 4217
- Total vector size (bp) 7467
-
Modifications to backboneRemoval of a 810nt long redundant fragment from the backbone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCulture medium: LB + 25ug/ml chloramphenicol
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
-
Alt nameThermoCas9
-
SpeciesGeobacillus thermodenitrificans T12
-
Insert Size (bp)3249
-
GenBank IDARP41326.1
- Promoter B. smithii xylL promoter
-
Tag
/ Fusion Protein
- None
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGAAGTATAAAATCGGTCTTG
- 3′ sequencing primer TTATAACGGACGGATAGTTTC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameThermoCas9 single guide RNA expressing module
-
Alt namesgRNA
-
SpeciesGeobacillus thermodenitrificans T12
-
Insert Size (bp)192
- Promoter B. coagulans DSM 1 pta promoter
-
Tag
/ Fusion Protein
- None
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggatcccatgacgctagtatccagctggGTCATAGTTCCCCTGAGAT
- 3′ sequencing primer CCCTCCCATGCACAATAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2017/08/18/177717 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pThermoCas9_ctrl was a gift from John van der Oost (Addgene plasmid # 100981 ; http://n2t.net/addgene:100981 ; RRID:Addgene_100981) -
For your References section:
Characterizing a thermostable Cas9 for bacterial genome editing and silencing. Mougiakos I, Mohanraju P, Bosma EF, Vrouwe V, Finger Bou M, Naduthodi MIS, Gussak A, Brinkman RBL, van Kranenburg R, van der Oost J. Nat Commun. 2017 Nov 21;8(1):1647. doi: 10.1038/s41467-017-01591-4. 10.1038/s41467-017-01591-4 [pii] PubMed 29162801