-
PurposeThe dCas9-TET1CD fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepINDUCER21 (ORF-EG)
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 10591
- Total vector size (bp) 16882
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-TET1CD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6291
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGTAGGCGTGTACGGTGGGAG
- 3′ sequencing primer TATCAACCACTTTGTACAAGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINDUCER dCas9-TET1CD was a gift from Danwei Huangfu (Addgene plasmid # 101921 ; http://n2t.net/addgene:101921 ; RRID:Addgene_101921) -
For your References section:
TET proteins safeguard bivalent promoters from de novo methylation in human embryonic stem cells. Verma N, Pan H, Dore LC, Shukla A, Li QV, Pelham-Webb B, Teijeiro V, Gonzalez F, Krivtsov A, Chang CJ, Papapetrou EP, He C, Elemento O, Huangfu D. Nat Genet. 2018 Jan;50(1):83-95. doi: 10.1038/s41588-017-0002-y. Epub 2017 Dec 4. 10.1038/s41588-017-0002-y PubMed 29203910