Skip to main content

PB-SAM-Dest
(Plasmid #102563)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102563 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB-SAM
  • Backbone size (bp) 16156
  • Vector type
    Mammalian Expression, CRISPR ; piggybac transposon
  • Promoter N/A
  • Selectable markers
    Hygromycin, Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer catgcttggttcggatgccc
  • 3′ sequencing primer gcattacacgtcttgagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCAS9-VP64 and MS2-P65-HSF1 cassettes are from Feng Zhang's lab (Addgene #61423 and #61425).

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-SAM-Dest was a gift from Ying Liu (Addgene plasmid # 102563 ; http://n2t.net/addgene:102563 ; RRID:Addgene_102563)
  • For your References section:

    One-Step piggyBac Transposon-Based CRISPR/Cas9 Activation of Multiple Genes. Li S, Zhang A, Xue H, Li D, Liu Y. Mol Ther Nucleic Acids. 2017 Sep 15;8:64-76. doi: 10.1016/j.omtn.2017.06.007. Epub 2017 Jun 15. 10.1016/j.omtn.2017.06.007 PubMed 28918057